Incidental Mutation 'R4894:Wdfy4'
ID 377515
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene Name WD repeat and FYVE domain containing 4
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 32681504-32907465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32877717 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 82 (H82Q)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061753
AA Change: H82Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: H82Q

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130509
AA Change: H82Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: H82Q

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 32,824,496 (GRCm39) missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32,681,934 (GRCm39) missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 32,825,994 (GRCm39) missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 32,873,618 (GRCm39) missense probably benign 0.01
IGL01700:Wdfy4 APN 14 32,742,195 (GRCm39) splice site probably benign
IGL01931:Wdfy4 APN 14 32,877,710 (GRCm39) missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 32,855,673 (GRCm39) missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 32,798,437 (GRCm39) missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 32,815,257 (GRCm39) missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 32,871,523 (GRCm39) missense probably benign
IGL02468:Wdfy4 APN 14 32,688,389 (GRCm39) missense probably benign 0.01
IGL02512:Wdfy4 APN 14 32,764,448 (GRCm39) missense probably benign 0.01
IGL02597:Wdfy4 APN 14 32,812,818 (GRCm39) nonsense probably null
IGL02752:Wdfy4 APN 14 32,798,283 (GRCm39) missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 32,817,262 (GRCm39) missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32,693,707 (GRCm39) missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 32,831,607 (GRCm39) missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 32,798,241 (GRCm39) missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 32,862,608 (GRCm39) missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32,688,392 (GRCm39) missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 32,884,827 (GRCm39) missense probably benign 0.01
IGL03198:Wdfy4 APN 14 32,847,844 (GRCm39) missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32,699,124 (GRCm39) missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 32,790,861 (GRCm39) missense probably benign 0.01
IGL03398:Wdfy4 APN 14 32,769,247 (GRCm39) missense probably benign 0.14
dodgers UTSW 14 32,699,063 (GRCm39) nonsense probably null
Dollar UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
Giants UTSW 14 32,792,575 (GRCm39) nonsense probably null
gigantea UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
kings_canyon UTSW 14 32,831,476 (GRCm39) nonsense probably null
moro UTSW 14 32,686,583 (GRCm39) splice site probably null
popped UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
sequoia UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
Sherman UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
stretched UTSW 14 32,795,492 (GRCm39) nonsense probably null
watchtower UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R0014:Wdfy4 UTSW 14 32,829,130 (GRCm39) missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 32,884,708 (GRCm39) missense probably null 1.00
R0085:Wdfy4 UTSW 14 32,800,200 (GRCm39) missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 32,805,742 (GRCm39) missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 32,805,769 (GRCm39) splice site probably benign
R0496:Wdfy4 UTSW 14 32,862,695 (GRCm39) splice site probably benign
R0514:Wdfy4 UTSW 14 32,802,732 (GRCm39) missense probably benign 0.22
R0548:Wdfy4 UTSW 14 32,764,578 (GRCm39) missense probably benign
R0590:Wdfy4 UTSW 14 32,763,131 (GRCm39) missense probably benign 0.09
R0647:Wdfy4 UTSW 14 32,831,656 (GRCm39) missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 32,862,569 (GRCm39) missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R1024:Wdfy4 UTSW 14 32,801,923 (GRCm39) missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32,693,695 (GRCm39) missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32,693,729 (GRCm39) splice site probably null
R1415:Wdfy4 UTSW 14 32,763,137 (GRCm39) missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 32,830,645 (GRCm39) missense probably benign 0.14
R1483:Wdfy4 UTSW 14 32,822,923 (GRCm39) missense probably benign 0.41
R1490:Wdfy4 UTSW 14 32,874,495 (GRCm39) critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32,682,765 (GRCm39) missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32,681,918 (GRCm39) missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 32,795,542 (GRCm39) critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 32,817,962 (GRCm39) missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 32,825,940 (GRCm39) missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 32,855,301 (GRCm39) missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32,693,641 (GRCm39) missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 32,828,001 (GRCm39) missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 32,868,946 (GRCm39) missense probably benign 0.11
R2241:Wdfy4 UTSW 14 32,795,468 (GRCm39) missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 32,884,764 (GRCm39) missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R2889:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R3114:Wdfy4 UTSW 14 32,811,860 (GRCm39) missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3758:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3797:Wdfy4 UTSW 14 32,862,602 (GRCm39) missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32,688,352 (GRCm39) missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 32,824,637 (GRCm39) splice site probably benign
R4091:Wdfy4 UTSW 14 32,847,837 (GRCm39) missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 32,818,040 (GRCm39) missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 32,809,912 (GRCm39) missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32,711,893 (GRCm39) missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 32,831,505 (GRCm39) missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 32,867,273 (GRCm39) missense probably benign 0.03
R4862:Wdfy4 UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32,710,852 (GRCm39) nonsense probably null
R4929:Wdfy4 UTSW 14 32,769,213 (GRCm39) missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 32,750,970 (GRCm39) missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 32,822,897 (GRCm39) missense probably benign 0.02
R5020:Wdfy4 UTSW 14 32,801,892 (GRCm39) missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 32,874,627 (GRCm39) missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 32,769,232 (GRCm39) missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 32,800,300 (GRCm39) missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 32,812,823 (GRCm39) missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32,710,856 (GRCm39) missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32,681,959 (GRCm39) missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 32,873,689 (GRCm39) missense probably benign 0.17
R5591:Wdfy4 UTSW 14 32,829,087 (GRCm39) missense probably benign 0.09
R5598:Wdfy4 UTSW 14 32,855,454 (GRCm39) missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
R5890:Wdfy4 UTSW 14 32,824,534 (GRCm39) missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 32,855,317 (GRCm39) missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 32,827,968 (GRCm39) missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32,693,668 (GRCm39) missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 32,831,482 (GRCm39) missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 32,823,006 (GRCm39) nonsense probably null
R6370:Wdfy4 UTSW 14 32,790,807 (GRCm39) missense probably benign 0.16
R6390:Wdfy4 UTSW 14 32,826,051 (GRCm39) missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32,689,604 (GRCm39) missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 32,830,649 (GRCm39) missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 32,868,901 (GRCm39) missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 32,769,208 (GRCm39) missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32,681,923 (GRCm39) missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 32,821,074 (GRCm39) missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32,686,583 (GRCm39) splice site probably null
R7101:Wdfy4 UTSW 14 32,682,777 (GRCm39) missense
R7114:Wdfy4 UTSW 14 32,693,531 (GRCm39) splice site probably null
R7139:Wdfy4 UTSW 14 32,873,535 (GRCm39) missense
R7255:Wdfy4 UTSW 14 32,696,239 (GRCm39) missense
R7324:Wdfy4 UTSW 14 32,769,271 (GRCm39) missense
R7379:Wdfy4 UTSW 14 32,873,566 (GRCm39) missense
R7399:Wdfy4 UTSW 14 32,790,863 (GRCm39) missense
R7408:Wdfy4 UTSW 14 32,800,264 (GRCm39) missense
R7410:Wdfy4 UTSW 14 32,696,191 (GRCm39) missense
R7411:Wdfy4 UTSW 14 32,828,088 (GRCm39) missense
R7412:Wdfy4 UTSW 14 32,871,541 (GRCm39) missense
R7445:Wdfy4 UTSW 14 32,792,575 (GRCm39) nonsense probably null
R7595:Wdfy4 UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32,707,696 (GRCm39) missense
R7622:Wdfy4 UTSW 14 32,800,231 (GRCm39) missense
R7828:Wdfy4 UTSW 14 32,710,878 (GRCm39) missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 32,812,920 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,792,705 (GRCm39) missense
R7986:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7990:Wdfy4 UTSW 14 32,819,752 (GRCm39) missense
R8001:Wdfy4 UTSW 14 32,695,492 (GRCm39) critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32,693,584 (GRCm39) missense
R8015:Wdfy4 UTSW 14 32,829,704 (GRCm39) missense
R8032:Wdfy4 UTSW 14 32,751,043 (GRCm39) nonsense probably null
R8041:Wdfy4 UTSW 14 32,875,965 (GRCm39) critical splice donor site probably null
R8090:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8092:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8112:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8114:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8115:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,699,063 (GRCm39) nonsense probably null
R8118:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8140:Wdfy4 UTSW 14 32,864,317 (GRCm39) missense
R8155:Wdfy4 UTSW 14 32,884,776 (GRCm39) missense
R8163:Wdfy4 UTSW 14 32,873,545 (GRCm39) missense
R8293:Wdfy4 UTSW 14 32,696,218 (GRCm39) missense
R8325:Wdfy4 UTSW 14 32,689,444 (GRCm39) missense
R8353:Wdfy4 UTSW 14 32,695,581 (GRCm39) missense probably benign
R8370:Wdfy4 UTSW 14 32,815,208 (GRCm39) missense
R8437:Wdfy4 UTSW 14 32,798,332 (GRCm39) missense
R8497:Wdfy4 UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 32,800,258 (GRCm39) missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32,693,722 (GRCm39) splice site probably benign
R8708:Wdfy4 UTSW 14 32,689,489 (GRCm39) missense
R8747:Wdfy4 UTSW 14 32,874,611 (GRCm39) missense
R8794:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R8846:Wdfy4 UTSW 14 32,867,105 (GRCm39) missense
R8880:Wdfy4 UTSW 14 32,795,492 (GRCm39) nonsense probably null
R9109:Wdfy4 UTSW 14 32,760,704 (GRCm39) splice site probably null
R9131:Wdfy4 UTSW 14 32,819,807 (GRCm39) missense
R9309:Wdfy4 UTSW 14 32,817,313 (GRCm39) missense
R9349:Wdfy4 UTSW 14 32,875,996 (GRCm39) missense
R9451:Wdfy4 UTSW 14 32,855,518 (GRCm39) missense
R9563:Wdfy4 UTSW 14 32,692,833 (GRCm39) missense
R9587:Wdfy4 UTSW 14 32,769,230 (GRCm39) nonsense probably null
R9599:Wdfy4 UTSW 14 32,855,428 (GRCm39) missense
R9670:Wdfy4 UTSW 14 32,769,219 (GRCm39) missense
R9718:Wdfy4 UTSW 14 32,847,893 (GRCm39) missense
R9742:Wdfy4 UTSW 14 32,809,987 (GRCm39) missense
X0028:Wdfy4 UTSW 14 32,802,593 (GRCm39) missense probably benign
X0053:Wdfy4 UTSW 14 32,884,899 (GRCm39) start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
Z1177:Wdfy4 UTSW 14 32,809,942 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCTTTCAGAAGAGAGCAGAGAGA -3'
(R):5'- TCGAAACCTAGCTCACAAATCCT -3'

Sequencing Primer
(F):5'- CAGAGAGAAGGAGACAGGTGAGTC -3'
(R):5'- GTGACGATTCCAGATCTTGCCAAG -3'
Posted On 2016-03-17