Incidental Mutation 'R4894:Wdr24'
ID 377521
Institutional Source Beutler Lab
Gene Symbol Wdr24
Ensembl Gene ENSMUSG00000025737
Gene Name WD repeat domain 24
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4894 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 26042601-26047704 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26045101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 279 (Y279H)
Ref Sequence ENSEMBL: ENSMUSP00000026833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000045692] [ENSMUST00000123582] [ENSMUST00000133595]
AlphaFold Q8CFJ9
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000026833
AA Change: Y279H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737
AA Change: Y279H

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045692
SMART Domains Protein: ENSMUSP00000048562
Gene: ENSMUSG00000025738

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
Blast:FBOX 98 137 2e-14 BLAST
LRR 241 266 1.32e1 SMART
LRR 267 291 1.61e2 SMART
LRR 293 318 1.76e2 SMART
LRR 319 344 3.21e-4 SMART
LRR 345 370 7.67e-2 SMART
LRR 371 396 6.13e-1 SMART
LRR 421 446 3.52e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123560
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Meta Mutation Damage Score 0.3685 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,609,975 (GRCm39) Y176* probably null Het
Akap13 T A 7: 75,375,068 (GRCm39) M1900K possibly damaging Het
Ankrd36 A G 11: 5,585,332 (GRCm39) E381G probably damaging Het
Ap3s1 T C 18: 46,891,183 (GRCm39) probably null Het
Cacna1e G T 1: 154,364,551 (GRCm39) S341* probably null Het
Camk1d G A 2: 5,359,539 (GRCm39) S161L probably damaging Het
Cdh23 G T 10: 60,173,630 (GRCm39) H1619Q probably benign Het
Chd7 T A 4: 8,838,629 (GRCm39) I1276N probably damaging Het
Clca3a1 A G 3: 144,719,662 (GRCm39) V436A probably damaging Het
Ctcfl G A 2: 172,959,196 (GRCm39) P177S probably benign Het
Dab2ip A G 2: 35,620,539 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epc1 A T 18: 6,449,011 (GRCm39) S495R probably benign Het
Espl1 A G 15: 102,230,758 (GRCm39) probably null Het
Eya4 T C 10: 22,985,753 (GRCm39) E583G possibly damaging Het
Fam111a C G 19: 12,565,913 (GRCm39) T554R probably benign Het
Fbh1 A T 2: 11,767,771 (GRCm39) I359N probably damaging Het
Fer1l6 T C 15: 58,490,751 (GRCm39) C1023R probably damaging Het
Helz2 G C 2: 180,877,940 (GRCm39) P953A probably benign Het
Ifi204 G T 1: 173,587,808 (GRCm39) S117Y probably damaging Het
Ift70a1 T C 2: 75,810,088 (GRCm39) *665W probably null Het
Igfn1 G A 1: 135,882,520 (GRCm39) T2775M probably damaging Het
Igsf9 A G 1: 172,325,634 (GRCm39) T1101A probably benign Het
Ipo13 A C 4: 117,760,638 (GRCm39) I614S probably damaging Het
Ipo13 A G 4: 117,761,687 (GRCm39) I476T possibly damaging Het
Kdm2b C A 5: 123,079,030 (GRCm39) E308* probably null Het
Klhl20 A T 1: 160,937,102 (GRCm39) M91K possibly damaging Het
Klrb1f T C 6: 129,030,151 (GRCm39) F64L probably benign Het
Ldlrad3 C T 2: 101,888,293 (GRCm39) C106Y probably damaging Het
Lilra6 T C 7: 3,915,530 (GRCm39) T161A probably benign Het
Lrriq1 A T 10: 102,997,613 (GRCm39) M1334K possibly damaging Het
Mepe C G 5: 104,473,268 (GRCm39) P3R probably damaging Het
Mgat4e A G 1: 134,468,856 (GRCm39) V396A probably benign Het
Nfx1 T G 4: 40,996,877 (GRCm39) S651A probably damaging Het
Or10ak13 A T 4: 118,639,483 (GRCm39) C100S probably damaging Het
Or2w6 T C 13: 21,843,352 (GRCm39) N47S probably damaging Het
Or4c109 T C 2: 88,817,783 (GRCm39) I254M possibly damaging Het
Rag2 T C 2: 101,460,022 (GRCm39) S111P probably damaging Het
Rai1 T A 11: 60,077,572 (GRCm39) D545E probably damaging Het
Ralgps1 A G 2: 33,033,115 (GRCm39) V498A possibly damaging Het
Rasal2 G A 1: 157,020,374 (GRCm39) S205L probably damaging Het
Rec8 T C 14: 55,862,787 (GRCm39) L582P probably damaging Het
Retn G A 8: 3,707,358 (GRCm39) R106H probably damaging Het
Rnf112 A G 11: 61,343,488 (GRCm39) L116P probably damaging Het
Rnf213 T C 11: 119,372,066 (GRCm39) Y4885H probably damaging Het
Sacm1l A G 9: 123,411,409 (GRCm39) I399M probably benign Het
Sez6 G T 11: 77,866,086 (GRCm39) G738V probably damaging Het
Spata17 A G 1: 186,872,643 (GRCm39) V56A probably benign Het
Spata31d1a A T 13: 59,849,542 (GRCm39) V862D probably damaging Het
Sptb A G 12: 76,671,768 (GRCm39) probably null Het
Srpk2 C A 5: 23,750,527 (GRCm39) G59W probably damaging Het
Tyro3 T C 2: 119,632,779 (GRCm39) S96P probably damaging Het
Ube2v1 A G 2: 167,452,280 (GRCm39) S108P probably damaging Het
Usp2 C T 9: 43,987,125 (GRCm39) S141L probably benign Het
Vamp5 T C 6: 72,347,181 (GRCm39) D46G possibly damaging Het
Vmn1r23 T A 6: 57,903,310 (GRCm39) Q156L probably benign Het
Vmn2r6 C T 3: 64,454,829 (GRCm39) S490N probably benign Het
Vps39 A T 2: 120,183,440 (GRCm39) I10N probably damaging Het
Vwf C T 6: 125,622,897 (GRCm39) Q1755* probably null Het
Wdfy4 A T 14: 32,877,717 (GRCm39) H82Q probably benign Het
Wdr72 A G 9: 74,117,843 (GRCm39) T852A probably benign Het
Zfp1 T A 8: 112,396,355 (GRCm39) C92* probably null Het
Zfp1004 T A 2: 150,033,899 (GRCm39) C104* probably null Het
Zfp426 A T 9: 20,386,369 (GRCm39) probably benign Het
Zfp442 C T 2: 150,253,130 (GRCm39) probably null Het
Zfp74 T C 7: 29,635,470 (GRCm39) probably benign Het
Other mutations in Wdr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Wdr24 APN 17 26,045,595 (GRCm39) missense probably benign 0.20
IGL01700:Wdr24 APN 17 26,044,802 (GRCm39) missense probably damaging 1.00
IGL01763:Wdr24 APN 17 26,045,164 (GRCm39) missense probably benign 0.20
IGL02567:Wdr24 APN 17 26,043,322 (GRCm39) missense probably damaging 0.99
IGL03100:Wdr24 APN 17 26,044,681 (GRCm39) missense possibly damaging 0.47
R0012:Wdr24 UTSW 17 26,046,087 (GRCm39) missense probably benign
R0799:Wdr24 UTSW 17 26,045,102 (GRCm39) missense probably damaging 1.00
R1015:Wdr24 UTSW 17 26,047,212 (GRCm39) missense probably benign 0.12
R1276:Wdr24 UTSW 17 26,046,441 (GRCm39) missense probably benign 0.02
R1297:Wdr24 UTSW 17 26,046,322 (GRCm39) missense possibly damaging 0.90
R1934:Wdr24 UTSW 17 26,043,240 (GRCm39) missense possibly damaging 0.89
R2030:Wdr24 UTSW 17 26,045,017 (GRCm39) missense probably benign 0.38
R2069:Wdr24 UTSW 17 26,045,256 (GRCm39) missense probably damaging 1.00
R2508:Wdr24 UTSW 17 26,043,273 (GRCm39) missense possibly damaging 0.52
R4601:Wdr24 UTSW 17 26,047,181 (GRCm39) splice site probably null
R4604:Wdr24 UTSW 17 26,047,479 (GRCm39) missense probably damaging 1.00
R5068:Wdr24 UTSW 17 26,044,753 (GRCm39) missense possibly damaging 0.77
R5088:Wdr24 UTSW 17 26,047,181 (GRCm39) splice site probably null
R5104:Wdr24 UTSW 17 26,043,565 (GRCm39) missense probably damaging 1.00
R5498:Wdr24 UTSW 17 26,043,535 (GRCm39) missense probably damaging 1.00
R5719:Wdr24 UTSW 17 26,047,314 (GRCm39) critical splice donor site probably null
R5892:Wdr24 UTSW 17 26,046,960 (GRCm39) missense probably benign 0.00
R5975:Wdr24 UTSW 17 26,046,102 (GRCm39) missense probably benign 0.37
R6084:Wdr24 UTSW 17 26,043,504 (GRCm39) missense probably damaging 0.99
R6106:Wdr24 UTSW 17 26,043,579 (GRCm39) missense probably benign
R6114:Wdr24 UTSW 17 26,043,579 (GRCm39) missense probably benign
R6116:Wdr24 UTSW 17 26,043,579 (GRCm39) missense probably benign
R6165:Wdr24 UTSW 17 26,045,395 (GRCm39) missense probably benign 0.18
R6175:Wdr24 UTSW 17 26,045,552 (GRCm39) missense probably damaging 1.00
R6331:Wdr24 UTSW 17 26,044,650 (GRCm39) missense possibly damaging 0.61
R6548:Wdr24 UTSW 17 26,046,899 (GRCm39) missense probably damaging 0.99
R6984:Wdr24 UTSW 17 26,047,209 (GRCm39) missense possibly damaging 0.93
R7485:Wdr24 UTSW 17 26,045,101 (GRCm39) missense probably damaging 1.00
R7583:Wdr24 UTSW 17 26,044,804 (GRCm39) missense probably null 1.00
R7770:Wdr24 UTSW 17 26,046,070 (GRCm39) missense probably benign 0.04
R8086:Wdr24 UTSW 17 26,045,101 (GRCm39) missense probably damaging 1.00
R8164:Wdr24 UTSW 17 26,044,923 (GRCm39) splice site probably null
R9210:Wdr24 UTSW 17 26,043,472 (GRCm39) missense probably benign 0.00
R9212:Wdr24 UTSW 17 26,043,472 (GRCm39) missense probably benign 0.00
R9567:Wdr24 UTSW 17 26,043,190 (GRCm39) missense probably damaging 0.98
R9667:Wdr24 UTSW 17 26,046,301 (GRCm39) missense possibly damaging 0.55
X0022:Wdr24 UTSW 17 26,043,246 (GRCm39) missense probably damaging 0.99
Z1177:Wdr24 UTSW 17 26,044,661 (GRCm39) missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGCTTGAGTGGGACATTCTCC -3'
(R):5'- TAACAGCAAAGGCCAGGTC -3'

Sequencing Primer
(F):5'- ACTGTGTGCAGACAATCG -3'
(R):5'- TTGGCACGCTCAACAGG -3'
Posted On 2016-03-17