Mutagenetix > Incidental Mutations

Incidental Mutation 'R4895:Uggt1'

377527

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

042499-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.666) question?

Stock #

R4895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36156264 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 1288 (F1288Y)

Ref Sequence

ENSEMBL: ENSMUSP00000037930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046875
AA Change: F1288Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: F1288Y

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173999

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Meta Mutation Damage Score

0.7160

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

98% (84/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519P11Rik	C	A	2: 154,613,070		probably benign	Het
Abat	G	A	16: 8,615,962	A392T	probably benign	Het
Abca14	G	A	7: 120,247,349		probably null	Het
Abcc6	A	T	7: 45,980,990	L1282Q	possibly damaging	Het
Acss2	A	G	2: 155,550,481		probably benign	Het
Adgrf1	G	T	17: 43,310,620	V583L	probably benign	Het
Aftph	T	C	11: 20,696,801	D825G	probably damaging	Het
Ahnak	T	C	19: 9,017,441	V5363A	probably benign	Het
Apba3	G	A	10: 81,271,283		probably null	Het
Asb13	T	C	13: 3,643,589	Y116H	probably damaging	Het
Asb4	C	A	6: 5,398,266	T77K	probably damaging	Het
Atp8b4	A	T	2: 126,414,369	H223Q	probably benign	Het
Best1	A	G	19: 9,992,771	L159P	probably benign	Het
Cacna1h	A	T	17: 25,389,422	M731K	probably damaging	Het
Catspere1	T	A	1: 177,859,861		noncoding transcript	Het
Cenpv	A	T	11: 62,527,520	Y202*	probably null	Het
Cep57	A	T	9: 13,816,153		probably benign	Het
Cfap100	T	A	6: 90,406,102	D363V	possibly damaging	Het
Cluh	A	G	11: 74,667,405	Y1126C	probably damaging	Het
Cyp2j5	A	G	4: 96,663,110		probably null	Het
Dnajc11	T	C	4: 151,979,933	F514L	probably damaging	Het
Efcab3	T	A	11: 105,117,401		probably benign	Het
Eif2b4	T	G	5: 31,192,954	Q8P	probably benign	Het
Epha6	A	T	16: 59,666,555	V1043E	probably benign	Het
Gm11562	G	T	11: 99,620,315	Q20K	unknown	Het
Gm11639	C	T	11: 104,720,286	T318I	probably benign	Het
Gm11639	A	G	11: 104,749,670	D1026G	probably damaging	Het
Gm13762	A	T	2: 88,973,711	F60Y	probably benign	Het
Gm14415	A	T	2: 177,104,321		noncoding transcript	Het
Gm5431	A	G	11: 48,889,028	S634P	probably damaging	Het
Gpld1	C	A	13: 24,979,728	N501K	probably damaging	Het
Gsn	C	T	2: 35,302,578	R513C	probably damaging	Het
Gulp1	T	C	1: 44,788,597	F300L	probably benign	Het
H2afj	T	C	6: 136,808,662	V108A	possibly damaging	Het
Haus3	T	C	5: 34,168,070	R82G	probably benign	Het
Herc2	G	A	7: 56,222,986	R4424H	probably damaging	Het
Hmcn1	T	A	1: 150,677,379	Q2520L	probably benign	Het
Hs2st1	T	C	3: 144,465,253	I53V	probably benign	Het
Inpp5e	C	T	2: 26,397,912	R624Q	probably damaging	Het
Ints8	G	T	4: 11,230,367	C491*	probably null	Het
Itpkb	C	A	1: 180,413,895	A710D	probably damaging	Het
Kcnk4	A	C	19: 6,928,416		probably null	Het
Kmt2d	T	C	15: 98,844,487		probably benign	Het
Lamb3	C	T	1: 193,332,314	R594*	probably null	Het
Map3k20	A	G	2: 72,402,356		probably benign	Het
Maz	A	T	7: 127,025,300		probably null	Het
Mtr	T	C	13: 12,216,866	T651A	probably benign	Het
Nbeal1	A	G	1: 60,292,903	E2252G	probably damaging	Het
Ndufa10	A	G	1: 92,469,896	Y61H	probably damaging	Het
Npat	T	A	9: 53,570,489	L1166M	probably damaging	Het
Olfr1112	A	C	2: 87,191,848	I54L	probably benign	Het
Olfr1447	C	T	19: 12,900,887	V298M	probably damaging	Het
Olfr190	C	T	16: 59,074,657	C141Y	probably benign	Het
Olfr490	A	C	7: 108,286,595	I177S	probably damaging	Het
Olfr988	A	T	2: 85,352,997	*310K	probably null	Het
Pcdhb3	T	C	18: 37,301,706	F242L	probably damaging	Het
Phip	A	G	9: 82,959,595	V57A	probably benign	Het
Plekha7	A	T	7: 116,189,391		probably null	Het
Pot1a	A	C	6: 25,753,206	F444V	probably damaging	Het
Ppm1a	C	T	12: 72,784,352	P217L	probably damaging	Het
Prepl	A	G	17: 85,081,066	F203S	probably damaging	Het
Prl8a1	T	C	13: 27,575,530	I175V	probably benign	Het
Ranbp6	A	T	19: 29,809,775	I1059N	possibly damaging	Het
Rhag	A	G	17: 40,811,351	Q59R	probably benign	Het
Sema4c	A	C	1: 36,553,570		probably null	Het
Sf3b3	T	C	8: 110,816,024	D902G	probably benign	Het
Tbc1d23	A	G	16: 57,198,857		probably null	Het
Tbrg1	A	T	9: 37,655,079	I54N	probably damaging	Het
Tchh	A	T	3: 93,445,686	E811V	unknown	Het
Tenm3	T	A	8: 48,300,971	D799V	probably damaging	Het
Tlr5	T	C	1: 182,974,199	L342P	probably damaging	Het
Tppp	C	T	13: 74,030,877	R146*	probably null	Het
Trpm4	A	T	7: 45,318,058	M574K	probably damaging	Het
Uggt2	T	A	14: 119,018,886	K1124N	probably damaging	Het
Usf3	A	C	16: 44,221,096	S1980R	possibly damaging	Het
Vav2	T	C	2: 27,318,961	D100G	probably damaging	Het
Vmn2r3	G	T	3: 64,259,761	H650N	probably benign	Het
Vmn2r59	T	A	7: 42,045,794	Y398F	probably damaging	Het
Zfp619	A	G	7: 39,537,972	D1142G	possibly damaging	Het
Zfp933	G	A	4: 147,826,435	R235*	probably null	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAACAGGCCATAATTTTGGG -3'
(R):5'- AGTGAAGGTCTCTGCCTAACTG -3'

Sequencing Primer
(F):5'- ACAGGCCATAATTTTGGGTTTAG -3'
(R):5'- GGTCTCTGCCTAACTGAACAATGG -3'

Posted On

2016-03-17