Incidental Mutation 'R4895:Abca14'
ID377570
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene NameATP-binding cassette, sub-family A (ABC1), member 14
Synonyms1700110B15Rik, 4930539G24Rik
MMRRC Submission 042499-MU
Accession Numbers

Genbank: NM_026458; MGI: 2388708

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120203961-120325352 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 120247349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
Predicted Effect probably null
Transcript: ENSMUST00000084640
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 120246853 missense probably damaging 1.00
IGL00800:Abca14 APN 7 120255390 missense probably benign 0.01
IGL00845:Abca14 APN 7 120223951 splice site probably benign
IGL00897:Abca14 APN 7 120216125 splice site probably benign
IGL01524:Abca14 APN 7 120253421 missense possibly damaging 0.57
IGL01747:Abca14 APN 7 120278087 missense probably benign 0.00
IGL02214:Abca14 APN 7 120294175 missense probably benign 0.09
IGL02215:Abca14 APN 7 120253389 missense probably benign 0.00
IGL02253:Abca14 APN 7 120207959 missense probably benign 0.29
IGL02302:Abca14 APN 7 120318745 splice site probably benign
IGL03391:Abca14 APN 7 120246884 missense probably damaging 1.00
F6893:Abca14 UTSW 7 120325038 missense probably damaging 0.98
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0265:Abca14 UTSW 7 120223627 missense probably benign 0.03
R0326:Abca14 UTSW 7 120224419 missense probably damaging 1.00
R0380:Abca14 UTSW 7 120278480 missense probably benign 0.03
R0418:Abca14 UTSW 7 120207434 missense probably damaging 1.00
R0539:Abca14 UTSW 7 120207797 missense probably damaging 1.00
R0574:Abca14 UTSW 7 120224497 missense probably damaging 0.96
R0611:Abca14 UTSW 7 120252256 missense possibly damaging 0.63
R0783:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0785:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0863:Abca14 UTSW 7 120216230 missense probably benign 0.03
R1034:Abca14 UTSW 7 120216147 missense probably damaging 1.00
R1056:Abca14 UTSW 7 120325072 missense probably damaging 1.00
R1072:Abca14 UTSW 7 120212769 missense probably benign
R1244:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1255:Abca14 UTSW 7 120207793 missense probably damaging 0.97
R1271:Abca14 UTSW 7 120325117 missense probably damaging 1.00
R1325:Abca14 UTSW 7 120247322 missense probably benign 0.32
R1457:Abca14 UTSW 7 120289460 missense probably benign 0.00
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1494:Abca14 UTSW 7 120216301 missense probably benign 0.00
R1551:Abca14 UTSW 7 120318878 missense probably benign 0.10
R1607:Abca14 UTSW 7 120251291 missense probably damaging 1.00
R1739:Abca14 UTSW 7 120278306 missense probably benign 0.04
R1856:Abca14 UTSW 7 120278181 missense probably damaging 1.00
R1875:Abca14 UTSW 7 120247967 missense possibly damaging 0.78
R1892:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1898:Abca14 UTSW 7 120251169 missense probably damaging 1.00
R1958:Abca14 UTSW 7 120325159 missense probably damaging 0.98
R2018:Abca14 UTSW 7 120216185 missense probably benign 0.00
R2039:Abca14 UTSW 7 120312264 missense probably damaging 0.98
R2060:Abca14 UTSW 7 120227518 nonsense probably null
R2202:Abca14 UTSW 7 120289541 missense probably benign 0.17
R2205:Abca14 UTSW 7 120247280 missense probably damaging 0.98
R2360:Abca14 UTSW 7 120251208 missense probably benign 0.00
R2401:Abca14 UTSW 7 120283089 missense probably damaging 1.00
R2426:Abca14 UTSW 7 120283223 missense probably benign 0.04
R3433:Abca14 UTSW 7 120294232 missense probably damaging 0.97
R4598:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4599:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4700:Abca14 UTSW 7 120312705 critical splice donor site probably null
R4751:Abca14 UTSW 7 120312177 missense probably benign 0.01
R4826:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4828:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4837:Abca14 UTSW 7 120246980 missense probably benign
R4881:Abca14 UTSW 7 120278249 missense possibly damaging 0.49
R4928:Abca14 UTSW 7 120324580 missense possibly damaging 0.90
R4990:Abca14 UTSW 7 120312165 missense probably benign 0.00
R5027:Abca14 UTSW 7 120312282 missense probably benign 0.05
R5091:Abca14 UTSW 7 120252274 missense probably damaging 1.00
R5158:Abca14 UTSW 7 120253429 missense probably benign
R5209:Abca14 UTSW 7 120232907 missense probably benign 0.01
R5333:Abca14 UTSW 7 120289546 nonsense probably null
R5424:Abca14 UTSW 7 120211554 missense probably benign 0.01
R5488:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5489:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5716:Abca14 UTSW 7 120246994 critical splice donor site probably null
R6450:Abca14 UTSW 7 120216226 missense probably benign 0.17
R6477:Abca14 UTSW 7 120325102 missense probably benign 0.44
R6652:Abca14 UTSW 7 120246941 missense probably damaging 1.00
R6782:Abca14 UTSW 7 120248085 missense probably damaging 1.00
R6874:Abca14 UTSW 7 120252205 missense possibly damaging 0.71
R6965:Abca14 UTSW 7 120283229 nonsense probably null
R7142:Abca14 UTSW 7 120251183 missense possibly damaging 0.89
R7146:Abca14 UTSW 7 120255297 missense probably benign 0.15
R7202:Abca14 UTSW 7 120318013 missense probably damaging 1.00
R7220:Abca14 UTSW 7 120227444 missense possibly damaging 0.45
R7241:Abca14 UTSW 7 120246961 missense probably damaging 1.00
R7291:Abca14 UTSW 7 120289609 nonsense probably null
R7296:Abca14 UTSW 7 120278311 missense probably benign
R7298:Abca14 UTSW 7 120207883 missense probably benign 0.00
R7315:Abca14 UTSW 7 120294118 missense probably benign 0.00
Z1088:Abca14 UTSW 7 120216135 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACTGCATAAACTCTGACTCCTC -3'
(R):5'- TGAATCTGCAGGAGTAGAGACC -3'

Sequencing Primer
(F):5'- GGAATACCTTTGCAGAACCA -3'
(R):5'- AGAACTCATTTCTGGGGATCAGTC -3'
Posted On2016-03-17