Incidental Mutation 'R4895:Sf3b3'
ID377572
Institutional Source Beutler Lab
Gene Symbol Sf3b3
Ensembl Gene ENSMUSG00000033732
Gene Namesplicing factor 3b, subunit 3
Synonyms5730409A01Rik, 1810061H24Rik, D8Ertd633e, SAP130, RSE1
MMRRC Submission 042499-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110810239-110846787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110816024 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 902 (D902G)
Ref Sequence ENSEMBL: ENSMUSP00000045073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042012]
Predicted Effect probably benign
Transcript: ENSMUST00000042012
AA Change: D902G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045073
Gene: ENSMUSG00000033732
AA Change: D902G

DomainStartEndE-ValueType
Blast:SH3 17 70 5e-13 BLAST
Pfam:MMS1_N 76 592 3.2e-185 PFAM
low complexity region 716 728 N/A INTRINSIC
Pfam:CPSF_A 863 1184 4.3e-104 PFAM
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Sf3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Sf3b3 APN 8 110813751 nonsense probably null
IGL00770:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL00774:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL01132:Sf3b3 APN 8 110842781 missense probably benign
IGL01487:Sf3b3 APN 8 110817660 missense probably benign 0.01
IGL02015:Sf3b3 APN 8 110816290 missense possibly damaging 0.82
IGL02126:Sf3b3 APN 8 110823443 missense probably benign
IGL02612:Sf3b3 APN 8 110842976 missense probably benign
IGL02833:Sf3b3 APN 8 110811977 critical splice donor site probably null
IGL03033:Sf3b3 APN 8 110810964 missense possibly damaging 0.62
IGL03366:Sf3b3 APN 8 110839954 missense probably damaging 1.00
R0458:Sf3b3 UTSW 8 110812136 splice site probably benign
R0907:Sf3b3 UTSW 8 110811510 splice site probably benign
R1344:Sf3b3 UTSW 8 110838303 missense probably damaging 0.98
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1736:Sf3b3 UTSW 8 110813832 missense probably benign
R1833:Sf3b3 UTSW 8 110817566 missense probably benign
R2225:Sf3b3 UTSW 8 110814573 missense probably damaging 1.00
R3236:Sf3b3 UTSW 8 110812020 missense probably damaging 0.99
R3615:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3616:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3683:Sf3b3 UTSW 8 110813621 critical splice donor site probably null
R4197:Sf3b3 UTSW 8 110821565 missense probably damaging 0.98
R4429:Sf3b3 UTSW 8 110826118 missense probably benign 0.01
R4674:Sf3b3 UTSW 8 110844505 missense probably damaging 0.99
R4931:Sf3b3 UTSW 8 110816329 missense probably benign 0.00
R4948:Sf3b3 UTSW 8 110813669 missense probably damaging 0.99
R4999:Sf3b3 UTSW 8 110841203 missense probably benign 0.34
R5150:Sf3b3 UTSW 8 110823376 missense possibly damaging 0.88
R5175:Sf3b3 UTSW 8 110833835 missense probably benign
R5559:Sf3b3 UTSW 8 110838215 missense probably benign 0.00
R5866:Sf3b3 UTSW 8 110814634 missense probably benign
R5934:Sf3b3 UTSW 8 110823470 missense probably damaging 0.99
R6270:Sf3b3 UTSW 8 110841820 missense probably damaging 1.00
R6803:Sf3b3 UTSW 8 110825578 missense probably benign 0.01
R7078:Sf3b3 UTSW 8 110813007 missense possibly damaging 0.90
R7252:Sf3b3 UTSW 8 110839930 missense probably damaging 0.99
R7467:Sf3b3 UTSW 8 110811456 missense possibly damaging 0.89
R7523:Sf3b3 UTSW 8 110813720 missense probably benign 0.35
R7544:Sf3b3 UTSW 8 110838283 missense probably benign 0.01
R7638:Sf3b3 UTSW 8 110820813 missense probably damaging 1.00
R7934:Sf3b3 UTSW 8 110821530 missense probably benign 0.05
R7973:Sf3b3 UTSW 8 110816290 missense possibly damaging 0.82
R8141:Sf3b3 UTSW 8 110820851 missense possibly damaging 0.87
X0024:Sf3b3 UTSW 8 110842932 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AACTTGACCCAGAAGCTTAGGG -3'
(R):5'- GGTGATGAACCCTATCCAGG -3'

Sequencing Primer
(F):5'- CCCAGAAGCTTAGGGCAAAAATG -3'
(R):5'- GGGGAATACACTAGACCTTGTCC -3'
Posted On2016-03-17