Incidental Mutation 'R4895:Asb13'
ID377587
Institutional Source Beutler Lab
Gene Symbol Asb13
Ensembl Gene ENSMUSG00000033781
Gene Nameankyrin repeat and SOCS box-containing 13
Synonyms6430573K02Rik, 2210015B19Rik
MMRRC Submission 042499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3634032-3653822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3643589 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 116 (Y116H)
Ref Sequence ENSEMBL: ENSMUSP00000046476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042288]
Predicted Effect probably damaging
Transcript: ENSMUST00000042288
AA Change: Y116H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046476
Gene: ENSMUSG00000033781
AA Change: Y116H

DomainStartEndE-ValueType
ANK 18 47 1.25e2 SMART
ANK 51 80 3.91e-3 SMART
ANK 84 113 1.53e-5 SMART
ANK 116 145 3.71e-4 SMART
ANK 149 178 6.65e-6 SMART
ANK 181 210 6.92e-4 SMART
SOCS_box 239 278 2.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157850
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Asb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Asb13 APN 13 3643476 missense probably null 1.00
IGL00929:Asb13 APN 13 3649427 missense probably damaging 1.00
IGL01533:Asb13 APN 13 3642164 missense probably benign 0.05
R0654:Asb13 UTSW 13 3642092 missense probably damaging 1.00
R0694:Asb13 UTSW 13 3649480 missense probably benign 0.16
R0883:Asb13 UTSW 13 3645052 critical splice donor site probably null
R2014:Asb13 UTSW 13 3649512 critical splice donor site probably null
R2290:Asb13 UTSW 13 3649418 missense probably damaging 1.00
R4320:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4322:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R4324:Asb13 UTSW 13 3645012 missense possibly damaging 0.69
R5305:Asb13 UTSW 13 3643479 missense probably damaging 1.00
R6417:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6420:Asb13 UTSW 13 3643574 missense probably damaging 1.00
R6813:Asb13 UTSW 13 3645029 missense probably damaging 1.00
R7648:Asb13 UTSW 13 3649332 missense probably damaging 1.00
R7735:Asb13 UTSW 13 3634180 splice site probably null
R7771:Asb13 UTSW 13 3649463 missense probably damaging 1.00
R7944:Asb13 UTSW 13 3649413 missense probably damaging 1.00
R8143:Asb13 UTSW 13 3642065 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTCATTGCACTCATTTGC -3'
(R):5'- ACATTCCAATCTCTCTGTGGAG -3'

Sequencing Primer
(F):5'- AGTGTCATTGCACTCATTTGCCTTAC -3'
(R):5'- GAGCAAAGGTCCTGAGTTCAATTCC -3'
Posted On2016-03-17