Incidental Mutation 'R4895:Kmt2d'
ID 377593
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll4, Mll2, C430014K11Rik
MMRRC Submission 042499-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4895 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 98729550-98769085 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 98742368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: K4264R
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: K4264R

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: K4264R
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: K4264R

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,454,990 (GRCm39) probably benign Het
Abat G A 16: 8,433,826 (GRCm39) A392T probably benign Het
Abca14 G A 7: 119,846,572 (GRCm39) probably null Het
Abcc6 A T 7: 45,630,414 (GRCm39) L1282Q possibly damaging Het
Acss2 A G 2: 155,392,401 (GRCm39) probably benign Het
Adgrf1 G T 17: 43,621,511 (GRCm39) V583L probably benign Het
Aftph T C 11: 20,646,801 (GRCm39) D825G probably damaging Het
Ahnak T C 19: 8,994,805 (GRCm39) V5363A probably benign Het
Apba3 G A 10: 81,107,117 (GRCm39) probably null Het
Asb13 T C 13: 3,693,589 (GRCm39) Y116H probably damaging Het
Asb4 C A 6: 5,398,266 (GRCm39) T77K probably damaging Het
Atp8b4 A T 2: 126,256,289 (GRCm39) H223Q probably benign Het
Best1 A G 19: 9,970,135 (GRCm39) L159P probably benign Het
Cacna1h A T 17: 25,608,396 (GRCm39) M731K probably damaging Het
Catspere1 T A 1: 177,687,427 (GRCm39) noncoding transcript Het
Cenpv A T 11: 62,418,346 (GRCm39) Y202* probably null Het
Cep57 A T 9: 13,727,449 (GRCm39) probably benign Het
Cfap100 T A 6: 90,383,084 (GRCm39) D363V possibly damaging Het
Cluh A G 11: 74,558,231 (GRCm39) Y1126C probably damaging Het
Cyp2j5 A G 4: 96,551,347 (GRCm39) probably null Het
Dnajc11 T C 4: 152,064,390 (GRCm39) F514L probably damaging Het
Efcab3 C T 11: 104,611,112 (GRCm39) T318I probably benign Het
Efcab3 A G 11: 104,640,496 (GRCm39) D1026G probably damaging Het
Efcab3 T A 11: 105,008,227 (GRCm39) probably benign Het
Eif2b4 T G 5: 31,350,298 (GRCm39) Q8P probably benign Het
Epha6 A T 16: 59,486,918 (GRCm39) V1043E probably benign Het
Gm11562 G T 11: 99,511,141 (GRCm39) Q20K unknown Het
Gm14415 A T 2: 176,796,114 (GRCm39) noncoding transcript Het
Gm5431 A G 11: 48,779,855 (GRCm39) S634P probably damaging Het
Gpld1 C A 13: 25,163,711 (GRCm39) N501K probably damaging Het
Gsn C T 2: 35,192,590 (GRCm39) R513C probably damaging Het
Gulp1 T C 1: 44,827,757 (GRCm39) F300L probably benign Het
H2aj T C 6: 136,785,660 (GRCm39) V108A possibly damaging Het
Haus3 T C 5: 34,325,414 (GRCm39) R82G probably benign Het
Herc2 G A 7: 55,872,734 (GRCm39) R4424H probably damaging Het
Hmcn1 T A 1: 150,553,130 (GRCm39) Q2520L probably benign Het
Hs2st1 T C 3: 144,171,014 (GRCm39) I53V probably benign Het
Inpp5e C T 2: 26,287,924 (GRCm39) R624Q probably damaging Het
Ints8 G T 4: 11,230,367 (GRCm39) C491* probably null Het
Itpkb C A 1: 180,241,460 (GRCm39) A710D probably damaging Het
Kcnk4 A C 19: 6,905,784 (GRCm39) probably null Het
Lamb3 C T 1: 193,014,622 (GRCm39) R594* probably null Het
Map3k20 A G 2: 72,232,700 (GRCm39) probably benign Het
Maz A T 7: 126,624,472 (GRCm39) probably null Het
Mtr T C 13: 12,231,752 (GRCm39) T651A probably benign Het
Nbeal1 A G 1: 60,332,062 (GRCm39) E2252G probably damaging Het
Ndufa10 A G 1: 92,397,618 (GRCm39) Y61H probably damaging Het
Npat T A 9: 53,481,789 (GRCm39) L1166M probably damaging Het
Or12e1 A C 2: 87,022,192 (GRCm39) I54L probably benign Het
Or4c108 A T 2: 88,804,055 (GRCm39) F60Y probably benign Het
Or5ak20 A T 2: 85,183,341 (GRCm39) *310K probably null Het
Or5b97 C T 19: 12,878,251 (GRCm39) V298M probably damaging Het
Or5h22 C T 16: 58,895,020 (GRCm39) C141Y probably benign Het
Or5p66 A C 7: 107,885,802 (GRCm39) I177S probably damaging Het
Pcdhb3 T C 18: 37,434,759 (GRCm39) F242L probably damaging Het
Phip A G 9: 82,841,648 (GRCm39) V57A probably benign Het
Plekha7 A T 7: 115,788,626 (GRCm39) probably null Het
Pot1a A C 6: 25,753,205 (GRCm39) F444V probably damaging Het
Ppm1a C T 12: 72,831,126 (GRCm39) P217L probably damaging Het
Prepl A G 17: 85,388,494 (GRCm39) F203S probably damaging Het
Prl8a1 T C 13: 27,759,513 (GRCm39) I175V probably benign Het
Ranbp6 A T 19: 29,787,175 (GRCm39) I1059N possibly damaging Het
Rhag A G 17: 41,122,242 (GRCm39) Q59R probably benign Het
Sema4c A C 1: 36,592,651 (GRCm39) probably null Het
Sf3b3 T C 8: 111,542,656 (GRCm39) D902G probably benign Het
Tbc1d23 A G 16: 57,019,220 (GRCm39) probably null Het
Tbrg1 A T 9: 37,566,375 (GRCm39) I54N probably damaging Het
Tchh A T 3: 93,352,993 (GRCm39) E811V unknown Het
Tenm3 T A 8: 48,754,006 (GRCm39) D799V probably damaging Het
Tlr5 T C 1: 182,801,764 (GRCm39) L342P probably damaging Het
Tppp C T 13: 74,178,996 (GRCm39) R146* probably null Het
Trpm4 A T 7: 44,967,482 (GRCm39) M574K probably damaging Het
Uggt1 A T 1: 36,195,345 (GRCm39) F1288Y probably damaging Het
Uggt2 T A 14: 119,256,298 (GRCm39) K1124N probably damaging Het
Usf3 A C 16: 44,041,459 (GRCm39) S1980R possibly damaging Het
Vav2 T C 2: 27,208,973 (GRCm39) D100G probably damaging Het
Vmn2r3 G T 3: 64,167,182 (GRCm39) H650N probably benign Het
Vmn2r59 T A 7: 41,695,218 (GRCm39) Y398F probably damaging Het
Zfp619 A G 7: 39,187,396 (GRCm39) D1142G possibly damaging Het
Zfp933 G A 4: 147,910,892 (GRCm39) R235* probably null Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98,760,214 (GRCm39) missense unknown
IGL00927:Kmt2d APN 15 98,742,890 (GRCm39) unclassified probably benign
IGL01123:Kmt2d APN 15 98,735,029 (GRCm39) missense unknown
IGL01288:Kmt2d APN 15 98,762,925 (GRCm39) missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98,758,538 (GRCm39) unclassified probably benign
IGL01575:Kmt2d APN 15 98,744,736 (GRCm39) utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98,754,250 (GRCm39) unclassified probably benign
IGL01750:Kmt2d APN 15 98,751,049 (GRCm39) unclassified probably benign
IGL02163:Kmt2d APN 15 98,733,109 (GRCm39) unclassified probably benign
IGL02209:Kmt2d APN 15 98,752,448 (GRCm39) unclassified probably benign
IGL02253:Kmt2d APN 15 98,756,056 (GRCm39) unclassified probably benign
IGL02271:Kmt2d APN 15 98,764,309 (GRCm39) missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98,763,373 (GRCm39) splice site probably benign
IGL02448:Kmt2d APN 15 98,741,991 (GRCm39) unclassified probably benign
IGL02472:Kmt2d APN 15 98,747,958 (GRCm39) missense probably benign 0.23
IGL02496:Kmt2d APN 15 98,755,439 (GRCm39) unclassified probably benign
IGL02527:Kmt2d APN 15 98,739,628 (GRCm39) unclassified probably benign
IGL02576:Kmt2d APN 15 98,762,001 (GRCm39) missense unknown
IGL02597:Kmt2d APN 15 98,761,712 (GRCm39) missense unknown
IGL02609:Kmt2d APN 15 98,749,674 (GRCm39) unclassified probably benign
IGL03085:Kmt2d APN 15 98,737,821 (GRCm39) unclassified probably benign
IGL03102:Kmt2d APN 15 98,753,424 (GRCm39) missense probably benign
IGL03123:Kmt2d APN 15 98,759,652 (GRCm39) missense unknown
G1citation:Kmt2d UTSW 15 98,747,340 (GRCm39) unclassified probably benign
R0091:Kmt2d UTSW 15 98,742,360 (GRCm39) unclassified probably benign
R0136:Kmt2d UTSW 15 98,752,159 (GRCm39) unclassified probably benign
R0243:Kmt2d UTSW 15 98,748,018 (GRCm39) unclassified probably benign
R0276:Kmt2d UTSW 15 98,748,192 (GRCm39) unclassified probably benign
R0477:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0478:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0586:Kmt2d UTSW 15 98,733,088 (GRCm39) unclassified probably benign
R0632:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0678:Kmt2d UTSW 15 98,748,294 (GRCm39) unclassified probably benign
R0780:Kmt2d UTSW 15 98,760,738 (GRCm39) missense unknown
R0891:Kmt2d UTSW 15 98,750,572 (GRCm39) unclassified probably benign
R1136:Kmt2d UTSW 15 98,755,646 (GRCm39) unclassified probably benign
R1417:Kmt2d UTSW 15 98,764,311 (GRCm39) missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98,742,819 (GRCm39) unclassified probably benign
R1510:Kmt2d UTSW 15 98,754,258 (GRCm39) unclassified probably benign
R1586:Kmt2d UTSW 15 98,762,934 (GRCm39) splice site probably benign
R1640:Kmt2d UTSW 15 98,742,938 (GRCm39) unclassified probably benign
R1714:Kmt2d UTSW 15 98,760,831 (GRCm39) missense unknown
R1725:Kmt2d UTSW 15 98,743,115 (GRCm39) unclassified probably benign
R1728:Kmt2d UTSW 15 98,763,013 (GRCm39) missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98,763,013 (GRCm39) missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98,743,115 (GRCm39) unclassified probably benign
R1744:Kmt2d UTSW 15 98,762,928 (GRCm39) missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98,762,259 (GRCm39) missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98,741,363 (GRCm39) unclassified probably benign
R1782:Kmt2d UTSW 15 98,755,429 (GRCm39) unclassified probably benign
R1789:Kmt2d UTSW 15 98,749,955 (GRCm39) unclassified probably benign
R1802:Kmt2d UTSW 15 98,760,866 (GRCm39) missense unknown
R1808:Kmt2d UTSW 15 98,764,567 (GRCm39) missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98,759,661 (GRCm39) missense unknown
R1831:Kmt2d UTSW 15 98,753,224 (GRCm39) missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98,753,472 (GRCm39) missense probably damaging 1.00
R1920:Kmt2d UTSW 15 98,753,471 (GRCm39) missense probably damaging 0.96
R1956:Kmt2d UTSW 15 98,757,471 (GRCm39) unclassified probably benign
R2100:Kmt2d UTSW 15 98,744,361 (GRCm39) unclassified probably benign
R2120:Kmt2d UTSW 15 98,737,410 (GRCm39) unclassified probably benign
R2188:Kmt2d UTSW 15 98,737,181 (GRCm39) unclassified probably benign
R2191:Kmt2d UTSW 15 98,758,930 (GRCm39) critical splice donor site probably null
R2234:Kmt2d UTSW 15 98,763,129 (GRCm39) missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98,760,147 (GRCm39) missense unknown
R2762:Kmt2d UTSW 15 98,749,936 (GRCm39) unclassified probably benign
R2895:Kmt2d UTSW 15 98,741,820 (GRCm39) unclassified probably benign
R3624:Kmt2d UTSW 15 98,740,783 (GRCm39) unclassified probably benign
R3791:Kmt2d UTSW 15 98,742,030 (GRCm39) unclassified probably benign
R3794:Kmt2d UTSW 15 98,735,240 (GRCm39) unclassified probably benign
R3871:Kmt2d UTSW 15 98,748,902 (GRCm39) unclassified probably benign
R3958:Kmt2d UTSW 15 98,753,430 (GRCm39) missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98,743,927 (GRCm39) unclassified probably benign
R4211:Kmt2d UTSW 15 98,738,070 (GRCm39) unclassified probably benign
R4212:Kmt2d UTSW 15 98,742,884 (GRCm39) unclassified probably benign
R4240:Kmt2d UTSW 15 98,742,452 (GRCm39) unclassified probably benign
R4246:Kmt2d UTSW 15 98,737,970 (GRCm39) unclassified probably benign
R4361:Kmt2d UTSW 15 98,761,551 (GRCm39) missense unknown
R4388:Kmt2d UTSW 15 98,751,507 (GRCm39) unclassified probably benign
R4602:Kmt2d UTSW 15 98,748,140 (GRCm39) unclassified probably benign
R4606:Kmt2d UTSW 15 98,737,597 (GRCm39) unclassified probably benign
R4658:Kmt2d UTSW 15 98,750,410 (GRCm39) unclassified probably benign
R4840:Kmt2d UTSW 15 98,759,775 (GRCm39) missense unknown
R4906:Kmt2d UTSW 15 98,747,420 (GRCm39) unclassified probably benign
R4976:Kmt2d UTSW 15 98,745,075 (GRCm39) utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98,754,043 (GRCm39) missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98,745,075 (GRCm39) utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98,738,105 (GRCm39) unclassified probably benign
R5260:Kmt2d UTSW 15 98,740,741 (GRCm39) unclassified probably benign
R5274:Kmt2d UTSW 15 98,752,111 (GRCm39) unclassified probably benign
R5450:Kmt2d UTSW 15 98,752,967 (GRCm39) missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5462:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5463:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5465:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5467:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5481:Kmt2d UTSW 15 98,759,886 (GRCm39) missense unknown
R5509:Kmt2d UTSW 15 98,737,557 (GRCm39) unclassified probably benign
R5534:Kmt2d UTSW 15 98,735,238 (GRCm39) unclassified probably benign
R5536:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5537:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5538:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5546:Kmt2d UTSW 15 98,750,949 (GRCm39) unclassified probably benign
R5595:Kmt2d UTSW 15 98,747,905 (GRCm39) unclassified probably benign
R5645:Kmt2d UTSW 15 98,742,278 (GRCm39) unclassified probably benign
R5679:Kmt2d UTSW 15 98,752,153 (GRCm39) unclassified probably benign
R5710:Kmt2d UTSW 15 98,751,987 (GRCm39) unclassified probably benign
R5755:Kmt2d UTSW 15 98,761,527 (GRCm39) missense unknown
R5817:Kmt2d UTSW 15 98,760,244 (GRCm39) missense unknown
R5841:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5842:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5843:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5844:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5845:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R6122:Kmt2d UTSW 15 98,758,573 (GRCm39) unclassified probably benign
R6612:Kmt2d UTSW 15 98,743,739 (GRCm39) unclassified probably benign
R6718:Kmt2d UTSW 15 98,748,420 (GRCm39) unclassified probably benign
R6718:Kmt2d UTSW 15 98,747,467 (GRCm39) unclassified probably benign
R6822:Kmt2d UTSW 15 98,747,340 (GRCm39) unclassified probably benign
R6866:Kmt2d UTSW 15 98,755,274 (GRCm39) unclassified probably benign
R6950:Kmt2d UTSW 15 98,737,901 (GRCm39) unclassified probably benign
R7089:Kmt2d UTSW 15 98,748,153 (GRCm39) missense unknown
R7120:Kmt2d UTSW 15 98,758,946 (GRCm39) missense unknown
R7131:Kmt2d UTSW 15 98,747,497 (GRCm39) unclassified probably benign
R7177:Kmt2d UTSW 15 98,748,267 (GRCm39) missense unknown
R7194:Kmt2d UTSW 15 98,741,714 (GRCm39) missense unknown
R7252:Kmt2d UTSW 15 98,742,147 (GRCm39) missense unknown
R7282:Kmt2d UTSW 15 98,751,985 (GRCm39) missense unknown
R7307:Kmt2d UTSW 15 98,747,299 (GRCm39) missense unknown
R7313:Kmt2d UTSW 15 98,754,504 (GRCm39) missense unknown
R7394:Kmt2d UTSW 15 98,754,265 (GRCm39) missense unknown
R7404:Kmt2d UTSW 15 98,743,376 (GRCm39) missense unknown
R7409:Kmt2d UTSW 15 98,753,235 (GRCm39) missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98,737,737 (GRCm39) missense unknown
R7534:Kmt2d UTSW 15 98,749,899 (GRCm39) missense unknown
R7575:Kmt2d UTSW 15 98,747,492 (GRCm39) unclassified probably benign
R7650:Kmt2d UTSW 15 98,748,751 (GRCm39) missense unknown
R7687:Kmt2d UTSW 15 98,760,001 (GRCm39) missense unknown
R7699:Kmt2d UTSW 15 98,741,600 (GRCm39) missense unknown
R7700:Kmt2d UTSW 15 98,741,600 (GRCm39) missense unknown
R7765:Kmt2d UTSW 15 98,750,215 (GRCm39) missense unknown
R7797:Kmt2d UTSW 15 98,762,287 (GRCm39) missense probably benign 0.24
R7803:Kmt2d UTSW 15 98,760,804 (GRCm39) missense unknown
R7952:Kmt2d UTSW 15 98,748,649 (GRCm39) missense unknown
R8054:Kmt2d UTSW 15 98,741,806 (GRCm39) missense unknown
R8084:Kmt2d UTSW 15 98,739,945 (GRCm39) missense unknown
R8089:Kmt2d UTSW 15 98,740,750 (GRCm39) missense unknown
R8133:Kmt2d UTSW 15 98,762,823 (GRCm39) missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98,741,534 (GRCm39) missense unknown
R8343:Kmt2d UTSW 15 98,750,478 (GRCm39) missense unknown
R8681:Kmt2d UTSW 15 98,743,948 (GRCm39) missense unknown
R8694:Kmt2d UTSW 15 98,742,615 (GRCm39) missense unknown
R8837:Kmt2d UTSW 15 98,762,048 (GRCm39) missense unknown
R8855:Kmt2d UTSW 15 98,754,237 (GRCm39) missense unknown
R8934:Kmt2d UTSW 15 98,759,767 (GRCm39) missense unknown
R9100:Kmt2d UTSW 15 98,747,832 (GRCm39) missense unknown
R9158:Kmt2d UTSW 15 98,741,020 (GRCm39) missense unknown
R9190:Kmt2d UTSW 15 98,749,896 (GRCm39) missense unknown
R9222:Kmt2d UTSW 15 98,747,324 (GRCm39) missense unknown
R9263:Kmt2d UTSW 15 98,747,499 (GRCm39) frame shift probably null
R9336:Kmt2d UTSW 15 98,743,697 (GRCm39) missense unknown
R9397:Kmt2d UTSW 15 98,747,994 (GRCm39) missense unknown
R9415:Kmt2d UTSW 15 98,737,586 (GRCm39) missense unknown
R9482:Kmt2d UTSW 15 98,763,046 (GRCm39) missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98,737,649 (GRCm39) missense unknown
R9610:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9611:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9611:Kmt2d UTSW 15 98,743,054 (GRCm39) unclassified probably benign
R9612:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9613:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9644:Kmt2d UTSW 15 98,743,385 (GRCm39) missense unknown
R9716:Kmt2d UTSW 15 98,741,283 (GRCm39) missense unknown
R9763:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9782:Kmt2d UTSW 15 98,764,597 (GRCm39) missense probably damaging 1.00
X0018:Kmt2d UTSW 15 98,750,803 (GRCm39) unclassified probably benign
X0024:Kmt2d UTSW 15 98,750,934 (GRCm39) unclassified probably benign
X0062:Kmt2d UTSW 15 98,747,700 (GRCm39) unclassified probably benign
Z1187:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1188:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1189:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1190:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1192:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTAGATAAGGCTCCTTGTGGGAC -3'
(R):5'- ACCTATGGCCCAGAACCTTC -3'

Sequencing Primer
(F):5'- AGGGGTCCTGTCTGAGATACAG -3'
(R):5'- GAACCTTCTGGGCTCCCAAC -3'
Posted On 2016-03-17