Incidental Mutation 'R4895:Abat'
ID377594
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission 042499-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8615962 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 392 (A392T)
Ref Sequence ENSEMBL: ENSMUSP00000111505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115839]
Predicted Effect probably benign
Transcript: ENSMUST00000065987
AA Change: A448T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880
AA Change: A448T

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
AA Change: A392T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880
AA Change: A392T

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128459
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6427:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
R7499:Abat UTSW 16 8603754 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGGCTGTAGACTGAGACTT -3'
(R):5'- CCCGCAACAAGAGAGTGGAT -3'

Sequencing Primer
(F):5'- GCTGTAGACTGAGACTTGACCAC -3'
(R):5'- AGAAGTCTCTCCTGAGCTAATGG -3'
Posted On2016-03-17