Incidental Mutation 'R0304:Zfp609'
ID37761
Institutional Source Beutler Lab
Gene Symbol Zfp609
Ensembl Gene ENSMUSG00000040524
Gene Namezinc finger protein 609
Synonyms
MMRRC Submission 038515-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R0304 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65692391-65827564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65701188 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1137 (E1137K)
Ref Sequence ENSEMBL: ENSMUSP00000124089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159109
AA Change: E1137K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124089
Gene: ENSMUSG00000040524
AA Change: E1137K

DomainStartEndE-ValueType
low complexity region 83 101 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 386 405 N/A INTRINSIC
ZnF_C2H2 495 520 2.14e0 SMART
low complexity region 629 638 N/A INTRINSIC
low complexity region 657 667 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 1000 1020 N/A INTRINSIC
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
low complexity region 1329 1348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159878
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik C T 4: 144,520,049 T55I probably benign Het
Acod1 T A 14: 103,054,982 I314N probably damaging Het
Actl11 T A 9: 107,929,768 V430E probably damaging Het
Adam19 A C 11: 46,127,392 D427A possibly damaging Het
Adarb2 C T 13: 8,752,570 probably benign Het
Akap7 A T 10: 25,271,552 H93Q probably damaging Het
Ankrd36 C A 11: 5,628,981 R82S possibly damaging Het
Arhgap21 A T 2: 20,859,801 probably benign Het
Atm T A 9: 53,516,344 I489F probably benign Het
AU019823 T C 9: 50,607,922 D130G probably damaging Het
Carmil1 T C 13: 24,139,341 S243G probably damaging Het
Cdc42bpg T C 19: 6,317,248 V939A probably damaging Het
Cel A C 2: 28,557,771 L377R probably benign Het
Clock A G 5: 76,226,985 V779A unknown Het
Cluap1 G A 16: 3,929,918 probably benign Het
Ctif A T 18: 75,521,818 H212Q probably benign Het
Cyp4a29 T A 4: 115,252,932 probably benign Het
Cytip T C 2: 58,148,246 N101S possibly damaging Het
D130043K22Rik T C 13: 24,864,815 M434T probably benign Het
Ddx47 A G 6: 135,017,220 I154V possibly damaging Het
Dnah6 C T 6: 73,159,115 E1014K probably damaging Het
Dnajc27 T G 12: 4,106,793 probably benign Het
Drc7 A T 8: 95,059,128 D204V probably damaging Het
Dsc3 A G 18: 19,981,241 Y319H probably damaging Het
Eml6 T C 11: 29,777,441 Q1227R probably benign Het
Enpp2 A T 15: 54,877,806 D365E probably benign Het
Ercc2 T C 7: 19,386,708 I199T possibly damaging Het
Exd2 G A 12: 80,491,240 probably benign Het
F2 A T 2: 91,633,233 I128N probably damaging Het
Fam219b T C 9: 57,538,876 L123P probably damaging Het
Fasn A G 11: 120,819,936 V299A possibly damaging Het
Fastkd2 T C 1: 63,752,400 V689A possibly damaging Het
Fbxw13 C T 9: 109,194,721 R85Q probably benign Het
Fer1l6 A G 15: 58,590,562 Y822C probably benign Het
Fhl5 T C 4: 25,207,241 T176A probably benign Het
Gm20530 T G 17: 36,094,226 noncoding transcript Het
Gm4787 A T 12: 81,378,934 I150N probably damaging Het
Grip1 G A 10: 120,075,471 S618N probably benign Het
Hdac9 T C 12: 34,374,111 K454E probably damaging Het
Iars2 T A 1: 185,287,156 I978F possibly damaging Het
Icosl A G 10: 78,075,322 Y299C probably benign Het
Idi1 T C 13: 8,890,357 Y192H probably damaging Het
Iqub T G 6: 24,454,291 Q531P probably damaging Het
Itih4 T A 14: 30,890,094 probably null Het
Izumo4 A T 10: 80,702,936 H71L probably damaging Het
Jcad A T 18: 4,673,325 E362D possibly damaging Het
Kif21a G T 15: 90,976,521 probably null Het
Kynu A T 2: 43,679,881 I392F probably damaging Het
Luc7l2 A G 6: 38,592,776 E223G probably damaging Het
Map3k8 A C 18: 4,339,552 L273R probably damaging Het
Max A G 12: 76,938,587 L119P probably benign Het
Mphosph9 T C 5: 124,298,829 N484S probably benign Het
Mrgprg A G 7: 143,765,055 Y107H probably damaging Het
Mrps31 A T 8: 22,421,338 I199F probably benign Het
Mtr C G 13: 12,222,154 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nptx2 A G 5: 144,553,650 probably benign Het
Nrip1 T C 16: 76,292,707 Q654R possibly damaging Het
Ocm A G 5: 144,024,534 F30L probably damaging Het
Olfr1216 G A 2: 89,013,288 R259W probably damaging Het
Olfr1223 A C 2: 89,144,764 Y86* probably null Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Olfr600 G T 7: 103,346,711 D72E probably damaging Het
Oosp1 T C 19: 11,690,969 M17V probably benign Het
Pax1 A T 2: 147,366,147 Y225F probably benign Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pkd1 C A 17: 24,585,946 Q3190K probably damaging Het
Pkn1 A C 8: 83,683,607 probably benign Het
Plin5 T C 17: 56,115,597 D113G probably damaging Het
Ppfia1 A G 7: 144,482,345 V1141A probably damaging Het
Ppp4r1 T A 17: 65,816,006 D334E probably benign Het
Ptov1 A T 7: 44,863,449 probably null Het
Rab22a G A 2: 173,661,459 V22M probably damaging Het
Rictor T A 15: 6,786,371 probably null Het
Sart1 G T 19: 5,380,531 probably benign Het
Scn11a G A 9: 119,819,862 A45V probably benign Het
Serpina5 A G 12: 104,103,200 T224A possibly damaging Het
Siglecf G T 7: 43,352,401 G212C probably damaging Het
Slc38a4 A T 15: 97,008,454 M378K probably damaging Het
Spata22 T A 11: 73,340,449 C176* probably null Het
Tmc3 G A 7: 83,596,139 E131K probably damaging Het
Trappc10 A T 10: 78,210,760 probably benign Het
Uvrag A G 7: 98,887,973 F672L probably benign Het
Vmn1r121 A G 7: 21,098,407 V36A possibly damaging Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r58 C T 7: 5,410,496 C245Y probably damaging Het
Vmn1r86 C A 7: 13,102,780 M56I probably benign Het
Wdr62 T C 7: 30,242,874 Y1051C probably benign Het
Xpnpep3 A G 15: 81,430,714 D205G probably damaging Het
Zdhhc14 T C 17: 5,725,336 probably benign Het
Zfp607a A T 7: 27,879,212 D569V possibly damaging Het
Zfp871 T C 17: 32,774,434 Y589C probably damaging Het
Zzef1 A T 11: 72,880,624 D1644V probably benign Het
Other mutations in Zfp609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Zfp609 APN 9 65702763 missense probably benign 0.18
IGL01688:Zfp609 APN 9 65704025 missense probably benign
IGL01718:Zfp609 APN 9 65702400 nonsense probably null
IGL01860:Zfp609 APN 9 65702834 missense possibly damaging 0.82
IGL02441:Zfp609 APN 9 65703329 missense possibly damaging 0.92
IGL02490:Zfp609 APN 9 65703968 missense possibly damaging 0.92
IGL02614:Zfp609 APN 9 65702790 missense probably damaging 0.96
IGL02794:Zfp609 APN 9 65704320 missense possibly damaging 0.83
IGL02959:Zfp609 APN 9 65703393 missense probably benign
IGL02967:Zfp609 APN 9 65697619 missense possibly damaging 0.83
IGL03036:Zfp609 APN 9 65702645 missense possibly damaging 0.89
IGL03182:Zfp609 APN 9 65701005 missense probably benign 0.02
H8441:Zfp609 UTSW 9 65794887 missense possibly damaging 0.82
R0487:Zfp609 UTSW 9 65702634 missense unknown
R0505:Zfp609 UTSW 9 65703462 missense possibly damaging 0.92
R0684:Zfp609 UTSW 9 65731201 missense probably benign 0.01
R1480:Zfp609 UTSW 9 65703311 missense possibly damaging 0.82
R1507:Zfp609 UTSW 9 65794777 missense possibly damaging 0.92
R1579:Zfp609 UTSW 9 65704472 missense possibly damaging 0.90
R1655:Zfp609 UTSW 9 65703554 missense possibly damaging 0.46
R1692:Zfp609 UTSW 9 65795311 missense probably damaging 0.98
R1701:Zfp609 UTSW 9 65731000 missense probably benign 0.05
R1735:Zfp609 UTSW 9 65703092 nonsense probably null
R1883:Zfp609 UTSW 9 65794758 missense probably benign
R1970:Zfp609 UTSW 9 65795277 missense probably damaging 0.96
R2059:Zfp609 UTSW 9 65704434 missense possibly damaging 0.83
R2302:Zfp609 UTSW 9 65794897 missense possibly damaging 0.66
R3404:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R3405:Zfp609 UTSW 9 65701172 missense possibly damaging 0.68
R4514:Zfp609 UTSW 9 65703695 missense possibly damaging 0.46
R4533:Zfp609 UTSW 9 65703608 missense probably benign 0.00
R5043:Zfp609 UTSW 9 65700827 missense probably damaging 0.97
R5499:Zfp609 UTSW 9 65702855 missense probably benign 0.00
R7081:Zfp609 UTSW 9 65702441 missense possibly damaging 0.46
R7514:Zfp609 UTSW 9 65706136 missense probably benign 0.05
R7677:Zfp609 UTSW 9 65697174 missense possibly damaging 0.61
R7684:Zfp609 UTSW 9 65731080 missense possibly damaging 0.66
X0028:Zfp609 UTSW 9 65697080 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCGTCTTCCTTGGGAACAGAG -3'
(R):5'- GGGGCACTGATAACTGCAAAGCAC -3'

Sequencing Primer
(F):5'- CCTTGGGAACAGAGTCCTTAC -3'
(R):5'- gggtctcgctatgtattcctg -3'
Posted On2013-05-23