Mutagenetix > Incidental Mutation

Incidental Mutation 'R4896:Hspg2'

377621

Institutional Source

Beutler Lab

Gene Symbol

Hspg2

Ensembl Gene

ENSMUSG00000028763

Gene Name

perlecan (heparan sulfate proteoglycan 2)

Synonyms

Plc, Pcn, per

MMRRC Submission

042500-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4896 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137468769-137570630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 137518940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1010 (R1010C)

Ref Sequence

ENSEMBL: ENSMUSP00000030547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030547
AA Change: R1010C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: R1010C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1113	1156	7.5e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2056	2117	4.81e-15	SMART
IGc2	2157	2216	1.37e-10	SMART
IGc2	2251	2312	5.88e-10	SMART
low complexity region	2333	2344	N/A	INTRINSIC
IGc2	2347	2408	1.97e-11	SMART
IGc2	2441	2502	1.59e-15	SMART
low complexity region	2517	2528	N/A	INTRINSIC
IGc2	2538	2599	3.08e-13	SMART
IGc2	2634	2695	9.25e-17	SMART
low complexity region	2704	2728	N/A	INTRINSIC
IGc2	2731	2792	1.84e-11	SMART
IGc2	2828	2889	2.11e-11	SMART
IGc2	2926	2987	3.25e-12	SMART
IG	3017	3098	3.62e-10	SMART
IGc2	3114	3180	9.05e-11	SMART
IGc2	3212	3273	2.44e-16	SMART
IGc2	3299	3360	2.26e-11	SMART
IGc2	3400	3461	6.81e-6	SMART
IGc2	3489	3550	1.59e-15	SMART
IGc2	3575	3636	2.54e-14	SMART
LamG	3672	3813	3.41e-39	SMART
EGF	3832	3866	6.91e-9	SMART
EGF	3872	3907	4.46e-3	SMART
LamG	3934	4070	4.78e-43	SMART
EGF	4092	4126	1.17e-6	SMART
EGF	4131	4161	1.87e-5	SMART
LamG	4211	4348	1.33e-41	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171332
AA Change: R1010C

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: R1010C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	53	78	N/A	INTRINSIC
SEA	80	194	4.94e-18	SMART
LDLa	198	236	4.51e-12	SMART
low complexity region	253	267	N/A	INTRINSIC
LDLa	284	321	1.62e-13	SMART
LDLa	324	361	2.59e-12	SMART
LDLa	367	405	3.86e-11	SMART
IGc2	419	486	4.06e-13	SMART
LamB	590	717	7.45e-54	SMART
EGF_Lam	764	811	6.05e-14	SMART
EGF_Lam	814	869	3.82e-2	SMART
EGF_like	871	921	6.74e-1	SMART
low complexity region	934	939	N/A	INTRINSIC
LamB	985	1112	2.87e-55	SMART
Pfam:Laminin_EGF	1114	1156	7.9e-5	PFAM
EGF_Lam	1159	1206	1.1e-11	SMART
EGF_Lam	1209	1263	2.46e-5	SMART
EGF_Lam	1275	1322	4.96e-10	SMART
LamB	1391	1516	5.3e-59	SMART
EGF_like	1516	1560	3.36e0	SMART
EGF_Lam	1563	1610	2.66e-10	SMART
EGF_Lam	1613	1668	3.73e-5	SMART
IGc2	1688	1752	1.76e-8	SMART
IGc2	1783	1846	5.97e-11	SMART
IGc2	1877	1939	8.57e-12	SMART
IGc2	1967	2031	1.82e-15	SMART
IGc2	2062	2123	4.81e-15	SMART
IGc2	2163	2222	1.37e-10	SMART
IGc2	2257	2318	5.88e-10	SMART
low complexity region	2339	2350	N/A	INTRINSIC
IGc2	2353	2414	1.97e-11	SMART
IGc2	2447	2508	1.59e-15	SMART
low complexity region	2523	2534	N/A	INTRINSIC
IGc2	2544	2605	3.08e-13	SMART
IGc2	2640	2701	9.25e-17	SMART
low complexity region	2710	2734	N/A	INTRINSIC
IGc2	2737	2798	1.84e-11	SMART
IGc2	2836	2897	2.11e-11	SMART
IGc2	2934	2995	3.25e-12	SMART
IG	3025	3106	3.62e-10	SMART
IGc2	3122	3188	9.05e-11	SMART
IGc2	3220	3281	2.44e-16	SMART
IGc2	3307	3368	2.26e-11	SMART
IGc2	3408	3469	6.81e-6	SMART
IGc2	3497	3558	1.59e-15	SMART
IGc2	3583	3644	2.54e-14	SMART
LamG	3680	3821	3.41e-39	SMART
EGF	3840	3874	6.91e-9	SMART
EGF	3880	3915	4.46e-3	SMART
LamG	3942	4078	4.78e-43	SMART
EGF	4100	4134	1.17e-6	SMART
EGF	4139	4169	1.87e-5	SMART
LamG	4219	4356	1.33e-41	SMART

Meta Mutation Damage Score

0.2034

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

99% (101/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,221,937	S1898P	probably benign	Het
4932438A13Rik	T	G	3: 36,965,937	N2108K	probably damaging	Het
Abcb4	T	C	5: 8,907,267	V132A	possibly damaging	Het
Acpp	A	T	9: 104,306,975	V292E	probably damaging	Het
Adamts10	T	C	17: 33,528,896	V102A	possibly damaging	Het
Add2	A	G	6: 86,096,746	T206A	probably benign	Het
Alg12	A	T	15: 88,816,188	L15Q	probably damaging	Het
Ankrd27	T	A	7: 35,608,375	D346E	probably damaging	Het
Armc2	A	T	10: 41,923,794	N689K	probably damaging	Het
Best3	T	A	10: 117,024,555	D573E	probably benign	Het
Ccdc80	A	T	16: 45,095,898	Q339L	probably benign	Het
Cdh9	T	C	15: 16,778,156	V19A	probably benign	Het
Cnksr1	A	T	4: 134,229,675		probably null	Het
Col7a1	T	A	9: 108,957,277	V525E	unknown	Het
Crebrf	T	C	17: 26,742,420	S172P	possibly damaging	Het
Csmd1	T	C	8: 16,009,439	I2099V	probably benign	Het
Dcaf4	T	A	12: 83,539,459	M400K	possibly damaging	Het
Dnah11	A	T	12: 117,995,200	F2983I	probably damaging	Het
Dock6	A	G	9: 21,824,437	V1005A	possibly damaging	Het
Dyrk2	C	A	10: 118,868,248	G34C	probably damaging	Het
Eif4a1	A	T	11: 69,668,597		probably benign	Het
Eno4	G	T	19: 58,964,543	D330Y	probably damaging	Het
Faf1	G	A	4: 109,842,299	C347Y	probably benign	Het
Fam169a	A	G	13: 97,097,592	Y124C	probably damaging	Het
Fam227a	G	T	15: 79,637,054	F269L	probably benign	Het
Fam60a	A	G	6: 148,933,000		probably null	Het
Fancm	C	A	12: 65,075,831	D42E	probably damaging	Het
Fat1	T	A	8: 44,951,280	I356N	possibly damaging	Het
Fer1l6	A	T	15: 58,638,020	T1444S	probably damaging	Het
Galr1	A	G	18: 82,393,940	L267P	probably damaging	Het
Gbx1	T	C	5: 24,504,839	H336R	probably damaging	Het
Gimap8	A	T	6: 48,659,347	Q682L	possibly damaging	Het
Gm2396	T	G	9: 88,931,228		noncoding transcript	Het
Gm5798	T	C	14: 41,348,657	L8S	probably damaging	Het
Hmgcll1	C	T	9: 76,056,178	S39F	possibly damaging	Het
Il3ra	A	T	14: 14,355,381	E289D	probably benign	Het
Isoc1	T	A	18: 58,673,278	L220Q	probably damaging	Het
Itga2	T	A	13: 114,853,766	K918*	probably null	Het
Kat6a	C	T	8: 22,938,313	T1228I	probably benign	Het
Klhl30	T	A	1: 91,359,324		probably null	Het
Krtap6-2	A	T	16: 89,419,918	C54S	unknown	Het
Lmf2	G	A	15: 89,351,800	P634S	probably benign	Het
Map3k4	A	G	17: 12,272,019	V175A	possibly damaging	Het
Mcm3	A	C	1: 20,820,256		probably benign	Het
Mon1b	T	C	8: 113,639,227	S396P	probably damaging	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Ncor2	A	G	5: 125,049,340		probably null	Het
Nlrc5	T	G	8: 94,521,216		probably benign	Het
Nlrp14	GT	GTT	7: 107,197,179		probably null	Het
Nwd2	T	G	5: 63,804,808	S578R	probably damaging	Het
Odf3	G	A	7: 140,848,485		probably benign	Het
Olfr1289	G	A	2: 111,483,660	V105I	possibly damaging	Het
Olfr360	A	G	2: 37,068,410	Y35C	probably damaging	Het
Otoa	C	A	7: 121,102,679	P194T	probably damaging	Het
Pde1b	A	C	15: 103,521,374	D98A	probably damaging	Het
Pi4ka	A	T	16: 17,377,169	C122S	probably damaging	Het
Pole2	C	T	12: 69,223,150	V67M	probably damaging	Het
Prickle2	A	T	6: 92,416,755	D312E	probably benign	Het
Prkd1	T	C	12: 50,389,962	D453G	probably damaging	Het
Prrc1	T	A	18: 57,374,554	V260E	probably damaging	Het
Reg3g	A	T	6: 78,467,810	Y62N	probably benign	Het
Reln	C	T	5: 21,955,238	G2111E	probably damaging	Het
Rsph6a	A	T	7: 19,057,740	E278V	possibly damaging	Het
Scpep1	T	A	11: 88,941,296	I203F	probably damaging	Het
Sec24d	T	C	3: 123,354,947	C747R	probably damaging	Het
Sec31a	A	T	5: 100,368,333	N967K	probably damaging	Het
Sell	T	C	1: 164,063,062	W5R	probably benign	Het
Siglec1	C	T	2: 131,069,869	V1697M	probably benign	Het
Slc22a26	T	A	19: 7,791,054	I213L	probably benign	Het
Slc2a13	G	A	15: 91,412,212	P300S	probably benign	Het
Slco1a4	A	G	6: 141,815,505	Y461H	possibly damaging	Het
Slco3a1	G	C	7: 74,320,556	C434W	probably null	Het
Sp3	A	T	2: 72,938,289	V666D	probably benign	Het
Spidr	A	T	16: 16,118,942	W100R	possibly damaging	Het
Stk33	T	A	7: 109,327,595	M286L	probably damaging	Het
Sult1c2	T	A	17: 53,832,135	I183F	probably benign	Het
Svep1	G	T	4: 58,087,751	T1776K	probably benign	Het
Tesk2	A	G	4: 116,802,993	H436R	probably benign	Het
Tex2	T	C	11: 106,568,404	T67A	probably damaging	Het
Timm10	T	C	2: 84,829,848	S44P	possibly damaging	Het
Tmed11	C	A	5: 108,795,182		probably null	Het
Trim12c	G	A	7: 104,340,948	R441C	probably damaging	Het
Trmt2a	A	G	16: 18,252,929	K509E	probably damaging	Het
Upk3a	A	G	15: 85,019,423	T108A	probably benign	Het
Usp29	A	G	7: 6,962,159	M334V	probably benign	Het
Vash1	A	G	12: 86,680,142	D52G	probably benign	Het
Vmn2r14	T	G	5: 109,220,380	T249P	probably benign	Het
Vmn2r43	A	T	7: 8,244,849	F772I	probably damaging	Het
Vmn2r75	G	T	7: 86,171,579	S49Y	probably benign	Het
Xdh	T	C	17: 73,910,243	T677A	probably damaging	Het
Zan	A	G	5: 137,386,456	L5102P	unknown	Het
Zfp160	T	A	17: 21,020,081	S9T	probably benign	Het
Zfp273	A	T	13: 67,825,554	H267L	probably damaging	Het
Zfp97	T	A	17: 17,144,776	I179K	probably benign	Het
Zfp975	T	C	7: 42,662,292	Y299C	probably damaging	Het

Other mutations in Hspg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Hspg2	APN	4	137528820	missense	probably damaging	1.00
IGL00339:Hspg2	APN	4	137539195	missense	probably damaging	1.00
IGL00943:Hspg2	APN	4	137562201	missense	probably benign	0.15
IGL00970:Hspg2	APN	4	137542590	missense	probably benign	0.09
IGL01011:Hspg2	APN	4	137559335	missense	probably damaging	1.00
IGL01148:Hspg2	APN	4	137546658	missense	probably benign	0.11
IGL01333:Hspg2	APN	4	137540314	missense	probably damaging	1.00
IGL01367:Hspg2	APN	4	137538489	missense	probably damaging	1.00
IGL01455:Hspg2	APN	4	137553817	missense	probably damaging	1.00
IGL01540:Hspg2	APN	4	137519706	missense	probably damaging	1.00
IGL01578:Hspg2	APN	4	137539183	missense	probably damaging	1.00
IGL01603:Hspg2	APN	4	137552803	missense	probably damaging	1.00
IGL01632:Hspg2	APN	4	137514773	missense	probably damaging	1.00
IGL01658:Hspg2	APN	4	137564926	missense	probably damaging	1.00
IGL01760:Hspg2	APN	4	137512671	missense	possibly damaging	0.60
IGL01976:Hspg2	APN	4	137561926	missense	probably damaging	1.00
IGL02024:Hspg2	APN	4	137540073	missense	probably damaging	1.00
IGL02033:Hspg2	APN	4	137552254	missense	probably benign
IGL02051:Hspg2	APN	4	137568389	unclassified	probably benign
IGL02124:Hspg2	APN	4	137518814	splice site	probably null
IGL02128:Hspg2	APN	4	137564016	missense	probably damaging	1.00
IGL02177:Hspg2	APN	4	137515316	missense	probably damaging	1.00
IGL02230:Hspg2	APN	4	137518645	missense	probably damaging	1.00
IGL02266:Hspg2	APN	4	137510577	missense	probably damaging	1.00
IGL02313:Hspg2	APN	4	137508389	missense	probably benign	0.03
IGL02477:Hspg2	APN	4	137544512	splice site	probably benign
IGL02514:Hspg2	APN	4	137569576	missense	probably benign	0.09
IGL02613:Hspg2	APN	4	137544420	missense	probably damaging	1.00
IGL02625:Hspg2	APN	4	137512642	missense	probably damaging	1.00
IGL02646:Hspg2	APN	4	137551848	missense	possibly damaging	0.60
IGL02651:Hspg2	APN	4	137557445	splice site	probably benign
IGL02701:Hspg2	APN	4	137557174	missense	probably damaging	0.96
IGL02833:Hspg2	APN	4	137555130	missense	probably benign	0.00
IGL02985:Hspg2	APN	4	137507803	missense	probably damaging	1.00
IGL03040:Hspg2	APN	4	137561825	critical splice donor site	probably null
IGL03181:Hspg2	APN	4	137515937	missense	probably damaging	1.00
IGL03349:Hspg2	APN	4	137560522	splice site	probably benign
G1patch:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
PIT4305001:Hspg2	UTSW	4	137550373	missense	possibly damaging	0.55
R0006:Hspg2	UTSW	4	137519931	missense	probably damaging	1.00
R0036:Hspg2	UTSW	4	137542849	missense	probably damaging	1.00
R0109:Hspg2	UTSW	4	137562201	missense	probably benign	0.15
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0131:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0132:Hspg2	UTSW	4	137551887	missense	probably damaging	1.00
R0245:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0388:Hspg2	UTSW	4	137511158	missense	probably damaging	1.00
R0389:Hspg2	UTSW	4	137515423	missense	possibly damaging	0.53
R0468:Hspg2	UTSW	4	137533529	missense	probably damaging	1.00
R0480:Hspg2	UTSW	4	137550024	missense	probably damaging	1.00
R0546:Hspg2	UTSW	4	137502294	missense	probably benign
R0599:Hspg2	UTSW	4	137512401	missense	probably damaging	0.98
R0652:Hspg2	UTSW	4	137514722	missense	probably damaging	1.00
R0671:Hspg2	UTSW	4	137553280	missense	probably damaging	1.00
R0760:Hspg2	UTSW	4	137512349	missense	probably damaging	1.00
R0883:Hspg2	UTSW	4	137541440	missense	probably benign	0.00
R1403:Hspg2	UTSW	4	137540100	missense	possibly damaging	0.90
R1417:Hspg2	UTSW	4	137517636	missense	probably benign
R1497:Hspg2	UTSW	4	137548096	missense	probably damaging	0.98
R1509:Hspg2	UTSW	4	137511241	splice site	probably benign
R1625:Hspg2	UTSW	4	137518971	missense	probably benign	0.23
R1630:Hspg2	UTSW	4	137518435	missense	probably damaging	1.00
R1651:Hspg2	UTSW	4	137533437	nonsense	probably null
R1699:Hspg2	UTSW	4	137548012	splice site	probably null
R1703:Hspg2	UTSW	4	137559151	missense	probably damaging	1.00
R1761:Hspg2	UTSW	4	137514673	missense	possibly damaging	0.90
R1775:Hspg2	UTSW	4	137520156	missense	probably damaging	0.99
R1779:Hspg2	UTSW	4	137518509	missense	probably damaging	1.00
R1843:Hspg2	UTSW	4	137545567	missense	probably damaging	1.00
R1891:Hspg2	UTSW	4	137565490	missense	probably damaging	1.00
R1930:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1931:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R1942:Hspg2	UTSW	4	137542552	missense	possibly damaging	0.67
R1959:Hspg2	UTSW	4	137564895	missense	probably damaging	1.00
R2042:Hspg2	UTSW	4	137568366	missense	probably damaging	1.00
R2062:Hspg2	UTSW	4	137559367	missense	possibly damaging	0.79
R2098:Hspg2	UTSW	4	137520109	missense	probably damaging	1.00
R2158:Hspg2	UTSW	4	137517604	missense	probably damaging	1.00
R2280:Hspg2	UTSW	4	137522043	missense	probably damaging	1.00
R2890:Hspg2	UTSW	4	137549574	missense	probably damaging	1.00
R2927:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R3428:Hspg2	UTSW	4	137555290	missense	probably damaging	1.00
R3744:Hspg2	UTSW	4	137565504	splice site	probably benign
R3873:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3874:Hspg2	UTSW	4	137539349	missense	probably damaging	1.00
R3917:Hspg2	UTSW	4	137559314	missense	probably damaging	1.00
R3932:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R3933:Hspg2	UTSW	4	137515568	missense	probably damaging	0.99
R4134:Hspg2	UTSW	4	137556657	missense	probably damaging	0.99
R4272:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4273:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4274:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4275:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4288:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4289:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4354:Hspg2	UTSW	4	137468911	missense	probably benign	0.17
R4355:Hspg2	UTSW	4	137529418	missense	probably damaging	0.98
R4400:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4411:Hspg2	UTSW	4	137562224	missense	probably benign
R4421:Hspg2	UTSW	4	137548122	missense	probably benign	0.01
R4592:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R4612:Hspg2	UTSW	4	137539575	missense	possibly damaging	0.80
R4619:Hspg2	UTSW	4	137546573	missense	probably damaging	1.00
R4658:Hspg2	UTSW	4	137533730	missense	probably damaging	1.00
R4667:Hspg2	UTSW	4	137539645	missense	possibly damaging	0.90
R4724:Hspg2	UTSW	4	137522127	missense	probably damaging	0.96
R4739:Hspg2	UTSW	4	137570073	unclassified	probably benign
R4793:Hspg2	UTSW	4	137529473	missense	possibly damaging	0.95
R4826:Hspg2	UTSW	4	137565395	missense	probably damaging	1.00
R4838:Hspg2	UTSW	4	137541666	missense	possibly damaging	0.53
R4926:Hspg2	UTSW	4	137542530	missense	probably damaging	1.00
R4939:Hspg2	UTSW	4	137508031	missense	probably damaging	1.00
R5032:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5033:Hspg2	UTSW	4	137518940	missense	probably damaging	1.00
R5071:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5072:Hspg2	UTSW	4	137540230	missense	probably damaging	1.00
R5114:Hspg2	UTSW	4	137511926	missense	probably damaging	1.00
R5177:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R5223:Hspg2	UTSW	4	137543914	missense	probably damaging	1.00
R5433:Hspg2	UTSW	4	137528794	splice site	probably null
R5529:Hspg2	UTSW	4	137551828	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137520551	missense	probably damaging	1.00
R5541:Hspg2	UTSW	4	137542825	missense	probably benign	0.17
R5546:Hspg2	UTSW	4	137548174	critical splice donor site	probably null
R5728:Hspg2	UTSW	4	137542766	missense	possibly damaging	0.95
R5764:Hspg2	UTSW	4	137561721	missense	probably damaging	1.00
R5920:Hspg2	UTSW	4	137553782	missense	probably damaging	1.00
R5934:Hspg2	UTSW	4	137518772	missense	probably damaging	1.00
R6074:Hspg2	UTSW	4	137540735	missense	probably benign
R6164:Hspg2	UTSW	4	137514655	missense	possibly damaging	0.89
R6175:Hspg2	UTSW	4	137569518	missense	probably damaging	1.00
R6217:Hspg2	UTSW	4	137540248	missense	probably damaging	0.99
R6262:Hspg2	UTSW	4	137519686	missense	probably damaging	1.00
R6299:Hspg2	UTSW	4	137544705	missense	probably damaging	1.00
R6333:Hspg2	UTSW	4	137561955	missense	probably damaging	1.00
R6371:Hspg2	UTSW	4	137541695	missense	probably damaging	1.00
R6430:Hspg2	UTSW	4	137539396	missense	probably damaging	1.00
R6498:Hspg2	UTSW	4	137507801	missense	possibly damaging	0.46
R6522:Hspg2	UTSW	4	137555275	missense	probably damaging	1.00
R6680:Hspg2	UTSW	4	137565737	missense	probably benign	0.18
R6724:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6725:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6762:Hspg2	UTSW	4	137551803	missense	possibly damaging	0.83
R6785:Hspg2	UTSW	4	137508398	missense	probably damaging	0.99
R6788:Hspg2	UTSW	4	137515307	missense	probably damaging	1.00
R6931:Hspg2	UTSW	4	137540720	missense	probably damaging	1.00
R6959:Hspg2	UTSW	4	137519289	missense	probably benign	0.45
R6968:Hspg2	UTSW	4	137535156	missense	probably damaging	1.00
R6988:Hspg2	UTSW	4	137528890	missense	probably damaging	1.00
R7021:Hspg2	UTSW	4	137542269	missense	possibly damaging	0.69
R7089:Hspg2	UTSW	4	137544366	missense	possibly damaging	0.51
R7107:Hspg2	UTSW	4	137510652	missense	probably damaging	1.00
R7141:Hspg2	UTSW	4	137552116	missense	probably damaging	1.00
R7161:Hspg2	UTSW	4	137514719	missense	probably damaging	1.00
R7189:Hspg2	UTSW	4	137533561	critical splice donor site	probably null
R7238:Hspg2	UTSW	4	137508393	missense	probably damaging	1.00
R7253:Hspg2	UTSW	4	137519946	missense	probably benign	0.15
R7278:Hspg2	UTSW	4	137551125	missense	probably damaging	0.98
R7287:Hspg2	UTSW	4	137529556	missense	probably benign	0.00
R7390:Hspg2	UTSW	4	137539179	missense	probably damaging	1.00
R7436:Hspg2	UTSW	4	137515664	missense	probably damaging	0.99
R7479:Hspg2	UTSW	4	137539403	missense	probably benign	0.17
R7516:Hspg2	UTSW	4	137542620	missense	possibly damaging	0.94
R7540:Hspg2	UTSW	4	137541440	missense	possibly damaging	0.51
R7603:Hspg2	UTSW	4	137548368	missense	probably damaging	1.00
R7603:Hspg2	UTSW	4	137557192	missense	possibly damaging	0.91
R7625:Hspg2	UTSW	4	137564938	missense	probably damaging	1.00
R7696:Hspg2	UTSW	4	137511966	missense	possibly damaging	0.78
R7767:Hspg2	UTSW	4	137511866	missense	probably damaging	1.00
R7815:Hspg2	UTSW	4	137512464	missense	probably damaging	1.00
R7825:Hspg2	UTSW	4	137558849	missense	probably damaging	1.00
R7863:Hspg2	UTSW	4	137564824	missense	probably benign	0.03
R7885:Hspg2	UTSW	4	137516837	missense	probably damaging	1.00
R7899:Hspg2	UTSW	4	137548116	missense	possibly damaging	0.72
R7937:Hspg2	UTSW	4	137550932	missense	probably benign	0.01
R7975:Hspg2	UTSW	4	137555221	missense	probably benign	0.26
R8078:Hspg2	UTSW	4	137508022	missense	probably damaging	1.00
R8285:Hspg2	UTSW	4	137512663	missense	probably benign	0.18
R8314:Hspg2	UTSW	4	137539675	missense	probably benign	0.12
R8322:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8323:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8324:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8341:Hspg2	UTSW	4	137518979	missense	possibly damaging	0.88
R8383:Hspg2	UTSW	4	137544370	missense	possibly damaging	0.66
R8425:Hspg2	UTSW	4	137550867	nonsense	probably null
R8491:Hspg2	UTSW	4	137553719	missense	probably benign	0.00
R8525:Hspg2	UTSW	4	137539448	missense	probably damaging	0.98
R8978:Hspg2	UTSW	4	137564030	missense	probably benign	0.09
R9152:Hspg2	UTSW	4	137522565	missense	possibly damaging	0.89
R9166:Hspg2	UTSW	4	137542874	missense	probably damaging	1.00
R9175:Hspg2	UTSW	4	137529346	missense	probably damaging	0.98
R9210:Hspg2	UTSW	4	137562479	missense	probably benign	0.05
R9221:Hspg2	UTSW	4	137560415	missense	possibly damaging	0.79
R9325:Hspg2	UTSW	4	137538241	missense	probably damaging	1.00
R9339:Hspg2	UTSW	4	137551169	missense	probably benign
R9340:Hspg2	UTSW	4	137569516	missense	probably damaging	1.00
R9358:Hspg2	UTSW	4	137517598	missense	probably damaging	1.00
R9451:Hspg2	UTSW	4	137511069	missense	probably damaging	1.00
R9534:Hspg2	UTSW	4	137540761	missense	probably benign
R9656:Hspg2	UTSW	4	137551885	missense	probably benign
R9664:Hspg2	UTSW	4	137539576	missense	probably benign	0.03
R9695:Hspg2	UTSW	4	137538390	missense	probably damaging	1.00
R9741:Hspg2	UTSW	4	137512651	missense	probably damaging	1.00
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
V5622:Hspg2	UTSW	4	137533738	missense	probably damaging	0.99
X0028:Hspg2	UTSW	4	137550391	missense	probably benign
Z1177:Hspg2	UTSW	4	137550467	missense	probably damaging	1.00
Z1177:Hspg2	UTSW	4	137564518	missense	probably damaging	0.99
Z1177:Hspg2	UTSW	4	137568373	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- GAACCCTACTTCTGGAGTCTTC -3'
(R):5'- ATCCATTCCTGACACCCTGG -3'

Sequencing Primer
(F):5'- TCTGGAGTCTTCCCGCCAG -3'
(R):5'- TGAGGCCCCCAAAGTGAG -3'

Posted On

2016-03-17