Incidental Mutation 'R0304:Scn11a'
ID 37764
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 038515-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0304 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119648928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 45 (A45V)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: A45V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: A45V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: A45V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 C T 4: 144,246,619 (GRCm39) T55I probably benign Het
Acod1 T A 14: 103,292,418 (GRCm39) I314N probably damaging Het
Actl11 T A 9: 107,806,967 (GRCm39) V430E probably damaging Het
Adam19 A C 11: 46,018,219 (GRCm39) D427A possibly damaging Het
Adarb2 C T 13: 8,802,606 (GRCm39) probably benign Het
Akap7 A T 10: 25,147,450 (GRCm39) H93Q probably damaging Het
Ankrd36 C A 11: 5,578,981 (GRCm39) R82S possibly damaging Het
Arhgap21 A T 2: 20,864,612 (GRCm39) probably benign Het
Atm T A 9: 53,427,644 (GRCm39) I489F probably benign Het
Carmil1 T C 13: 24,323,324 (GRCm39) S243G probably damaging Het
Cdc42bpg T C 19: 6,367,278 (GRCm39) V939A probably damaging Het
Cel A C 2: 28,447,783 (GRCm39) L377R probably benign Het
Clock A G 5: 76,374,832 (GRCm39) V779A unknown Het
Cluap1 G A 16: 3,747,782 (GRCm39) probably benign Het
Ctif A T 18: 75,654,889 (GRCm39) H212Q probably benign Het
Cyp4a29 T A 4: 115,110,129 (GRCm39) probably benign Het
Cytip T C 2: 58,038,258 (GRCm39) N101S possibly damaging Het
D130043K22Rik T C 13: 25,048,798 (GRCm39) M434T probably benign Het
Ddx47 A G 6: 134,994,183 (GRCm39) I154V possibly damaging Het
Dnah6 C T 6: 73,136,098 (GRCm39) E1014K probably damaging Het
Dnajc27 T G 12: 4,156,793 (GRCm39) probably benign Het
Drc7 A T 8: 95,785,756 (GRCm39) D204V probably damaging Het
Dsc3 A G 18: 20,114,298 (GRCm39) Y319H probably damaging Het
Eml6 T C 11: 29,727,441 (GRCm39) Q1227R probably benign Het
Enpp2 A T 15: 54,741,202 (GRCm39) D365E probably benign Het
Ercc2 T C 7: 19,120,633 (GRCm39) I199T possibly damaging Het
Exd2 G A 12: 80,538,014 (GRCm39) probably benign Het
F2 A T 2: 91,463,578 (GRCm39) I128N probably damaging Het
Fam219b T C 9: 57,446,159 (GRCm39) L123P probably damaging Het
Fasn A G 11: 120,710,762 (GRCm39) V299A possibly damaging Het
Fastkd2 T C 1: 63,791,559 (GRCm39) V689A possibly damaging Het
Fbxw13 C T 9: 109,023,789 (GRCm39) R85Q probably benign Het
Fer1l6 A G 15: 58,462,411 (GRCm39) Y822C probably benign Het
Fhl5 T C 4: 25,207,241 (GRCm39) T176A probably benign Het
Gm20530 T G 17: 36,405,118 (GRCm39) noncoding transcript Het
Gm4787 A T 12: 81,425,708 (GRCm39) I150N probably damaging Het
Grip1 G A 10: 119,911,376 (GRCm39) S618N probably benign Het
Hdac9 T C 12: 34,424,110 (GRCm39) K454E probably damaging Het
Iars2 T A 1: 185,019,353 (GRCm39) I978F possibly damaging Het
Icosl A G 10: 77,911,156 (GRCm39) Y299C probably benign Het
Idi1 T C 13: 8,940,393 (GRCm39) Y192H probably damaging Het
Iqub T G 6: 24,454,290 (GRCm39) Q531P probably damaging Het
Itih4 T A 14: 30,612,051 (GRCm39) probably null Het
Izumo4 A T 10: 80,538,770 (GRCm39) H71L probably damaging Het
Jcad A T 18: 4,673,325 (GRCm39) E362D possibly damaging Het
Kif21a G T 15: 90,860,724 (GRCm39) probably null Het
Kynu A T 2: 43,569,893 (GRCm39) I392F probably damaging Het
Luc7l2 A G 6: 38,569,711 (GRCm39) E223G probably damaging Het
Map3k8 A C 18: 4,339,552 (GRCm39) L273R probably damaging Het
Max A G 12: 76,985,361 (GRCm39) L119P probably benign Het
Mphosph9 T C 5: 124,436,892 (GRCm39) N484S probably benign Het
Mrgprg A G 7: 143,318,792 (GRCm39) Y107H probably damaging Het
Mrps31 A T 8: 22,911,354 (GRCm39) I199F probably benign Het
Mtr C G 13: 12,237,040 (GRCm39) probably null Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Nkapd1 T C 9: 50,519,222 (GRCm39) D130G probably damaging Het
Nptx2 A G 5: 144,490,460 (GRCm39) probably benign Het
Nrip1 T C 16: 76,089,595 (GRCm39) Q654R possibly damaging Het
Ocm A G 5: 143,961,352 (GRCm39) F30L probably damaging Het
Oosp1 T C 19: 11,668,333 (GRCm39) M17V probably benign Het
Or14c45 C T 7: 86,176,195 (GRCm39) P77S probably damaging Het
Or4c111 G A 2: 88,843,632 (GRCm39) R259W probably damaging Het
Or4c118 A C 2: 88,975,108 (GRCm39) Y86* probably null Het
Or52ad1 G T 7: 102,995,918 (GRCm39) D72E probably damaging Het
Pax1 A T 2: 147,208,067 (GRCm39) Y225F probably benign Het
Pde4dip T A 3: 97,751,028 (GRCm39) H62L probably benign Het
Pkd1 C A 17: 24,804,920 (GRCm39) Q3190K probably damaging Het
Pkn1 A C 8: 84,410,236 (GRCm39) probably benign Het
Plin5 T C 17: 56,422,597 (GRCm39) D113G probably damaging Het
Ppfia1 A G 7: 144,036,082 (GRCm39) V1141A probably damaging Het
Ppp4r1 T A 17: 66,123,001 (GRCm39) D334E probably benign Het
Ptov1 A T 7: 44,512,873 (GRCm39) probably null Het
Rab22a G A 2: 173,503,252 (GRCm39) V22M probably damaging Het
Rictor T A 15: 6,815,852 (GRCm39) probably null Het
Sart1 G T 19: 5,430,559 (GRCm39) probably benign Het
Serpina5 A G 12: 104,069,459 (GRCm39) T224A possibly damaging Het
Siglecf G T 7: 43,001,825 (GRCm39) G212C probably damaging Het
Slc38a4 A T 15: 96,906,335 (GRCm39) M378K probably damaging Het
Spata22 T A 11: 73,231,275 (GRCm39) C176* probably null Het
Tmc3 G A 7: 83,245,347 (GRCm39) E131K probably damaging Het
Trappc10 A T 10: 78,046,594 (GRCm39) probably benign Het
Uvrag A G 7: 98,537,180 (GRCm39) F672L probably benign Het
Vmn1r121 A G 7: 20,832,332 (GRCm39) V36A possibly damaging Het
Vmn1r13 A T 6: 57,187,611 (GRCm39) M257L probably benign Het
Vmn1r58 C T 7: 5,413,495 (GRCm39) C245Y probably damaging Het
Vmn1r86 C A 7: 12,836,707 (GRCm39) M56I probably benign Het
Wdr62 T C 7: 29,942,299 (GRCm39) Y1051C probably benign Het
Xpnpep3 A G 15: 81,314,915 (GRCm39) D205G probably damaging Het
Zdhhc14 T C 17: 5,775,611 (GRCm39) probably benign Het
Zfp607a A T 7: 27,578,637 (GRCm39) D569V possibly damaging Het
Zfp609 C T 9: 65,608,470 (GRCm39) E1137K possibly damaging Het
Zfp871 T C 17: 32,993,408 (GRCm39) Y589C probably damaging Het
Zzef1 A T 11: 72,771,450 (GRCm39) D1644V probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCCACCTGCATGAGAATGTACC -3'
(R):5'- TGCAGACTTCCAGGACACTATCCC -3'

Sequencing Primer
(F):5'- CCTGCATGAGAATGTACCTTATGG -3'
(R):5'- GACACTATCCCTTGAGAGTGAGC -3'
Posted On 2013-05-23