Mutagenetix > Incidental Mutation

Incidental Mutation 'R4896:Dnah11'

377669

Institutional Source

Beutler Lab

Gene Symbol

Dnah11

Ensembl Gene

ENSMUSG00000018581

Gene Name

dynein, axonemal, heavy chain 11

Synonyms

b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo

MMRRC Submission

042500-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R4896 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117877982-118199043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117995200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 2983 (F2983I)

Ref Sequence

ENSEMBL: ENSMUSP00000081867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084806]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084806
AA Change: F2983I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: F2983I

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:DHC_N1	218	794	1.6e-162	PFAM
low complexity region	1266	1282	N/A	INTRINSIC
Pfam:DHC_N2	1297	1705	1e-130	PFAM
low complexity region	1757	1773	N/A	INTRINSIC
AAA	1869	1963	1.51e0	SMART
Pfam:AAA_5	2150	2286	1.6e-12	PFAM
AAA	2474	2619	1.48e-1	SMART
AAA	2819	2931	4.57e-1	SMART
Pfam:MT	3069	3413	3.2e-162	PFAM
Pfam:AAA_9	3434	3656	2.9e-88	PFAM
Pfam:Dynein_heavy	3790	4486	7.1e-235	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000176756
AA Change: F1079I

Meta Mutation Damage Score

0.6414

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

99% (101/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,221,937	S1898P	probably benign	Het
4932438A13Rik	T	G	3: 36,965,937	N2108K	probably damaging	Het
Abcb4	T	C	5: 8,907,267	V132A	possibly damaging	Het
Acpp	A	T	9: 104,306,975	V292E	probably damaging	Het
Adamts10	T	C	17: 33,528,896	V102A	possibly damaging	Het
Add2	A	G	6: 86,096,746	T206A	probably benign	Het
Alg12	A	T	15: 88,816,188	L15Q	probably damaging	Het
Ankrd27	T	A	7: 35,608,375	D346E	probably damaging	Het
Armc2	A	T	10: 41,923,794	N689K	probably damaging	Het
Best3	T	A	10: 117,024,555	D573E	probably benign	Het
Ccdc80	A	T	16: 45,095,898	Q339L	probably benign	Het
Cdh9	T	C	15: 16,778,156	V19A	probably benign	Het
Cnksr1	A	T	4: 134,229,675		probably null	Het
Col7a1	T	A	9: 108,957,277	V525E	unknown	Het
Crebrf	T	C	17: 26,742,420	S172P	possibly damaging	Het
Csmd1	T	C	8: 16,009,439	I2099V	probably benign	Het
Dcaf4	T	A	12: 83,539,459	M400K	possibly damaging	Het
Dock6	A	G	9: 21,824,437	V1005A	possibly damaging	Het
Dyrk2	C	A	10: 118,868,248	G34C	probably damaging	Het
Eif4a1	A	T	11: 69,668,597		probably benign	Het
Eno4	G	T	19: 58,964,543	D330Y	probably damaging	Het
Faf1	G	A	4: 109,842,299	C347Y	probably benign	Het
Fam169a	A	G	13: 97,097,592	Y124C	probably damaging	Het
Fam227a	G	T	15: 79,637,054	F269L	probably benign	Het
Fam60a	A	G	6: 148,933,000		probably null	Het
Fancm	C	A	12: 65,075,831	D42E	probably damaging	Het
Fat1	T	A	8: 44,951,280	I356N	possibly damaging	Het
Fer1l6	A	T	15: 58,638,020	T1444S	probably damaging	Het
Galr1	A	G	18: 82,393,940	L267P	probably damaging	Het
Gbx1	T	C	5: 24,504,839	H336R	probably damaging	Het
Gimap8	A	T	6: 48,659,347	Q682L	possibly damaging	Het
Gm2396	T	G	9: 88,931,228		noncoding transcript	Het
Gm5798	T	C	14: 41,348,657	L8S	probably damaging	Het
Hmgcll1	C	T	9: 76,056,178	S39F	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Il3ra	A	T	14: 14,355,381	E289D	probably benign	Het
Isoc1	T	A	18: 58,673,278	L220Q	probably damaging	Het
Itga2	T	A	13: 114,853,766	K918*	probably null	Het
Kat6a	C	T	8: 22,938,313	T1228I	probably benign	Het
Klhl30	T	A	1: 91,359,324		probably null	Het
Krtap6-2	A	T	16: 89,419,918	C54S	unknown	Het
Lmf2	G	A	15: 89,351,800	P634S	probably benign	Het
Map3k4	A	G	17: 12,272,019	V175A	possibly damaging	Het
Mcm3	A	C	1: 20,820,256		probably benign	Het
Mon1b	T	C	8: 113,639,227	S396P	probably damaging	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Ncor2	A	G	5: 125,049,340		probably null	Het
Nlrc5	T	G	8: 94,521,216		probably benign	Het
Nlrp14	GT	GTT	7: 107,197,179		probably null	Het
Nwd2	T	G	5: 63,804,808	S578R	probably damaging	Het
Odf3	G	A	7: 140,848,485		probably benign	Het
Olfr1289	G	A	2: 111,483,660	V105I	possibly damaging	Het
Olfr360	A	G	2: 37,068,410	Y35C	probably damaging	Het
Otoa	C	A	7: 121,102,679	P194T	probably damaging	Het
Pde1b	A	C	15: 103,521,374	D98A	probably damaging	Het
Pi4ka	A	T	16: 17,377,169	C122S	probably damaging	Het
Pole2	C	T	12: 69,223,150	V67M	probably damaging	Het
Prickle2	A	T	6: 92,416,755	D312E	probably benign	Het
Prkd1	T	C	12: 50,389,962	D453G	probably damaging	Het
Prrc1	T	A	18: 57,374,554	V260E	probably damaging	Het
Reg3g	A	T	6: 78,467,810	Y62N	probably benign	Het
Reln	C	T	5: 21,955,238	G2111E	probably damaging	Het
Rsph6a	A	T	7: 19,057,740	E278V	possibly damaging	Het
Scpep1	T	A	11: 88,941,296	I203F	probably damaging	Het
Sec24d	T	C	3: 123,354,947	C747R	probably damaging	Het
Sec31a	A	T	5: 100,368,333	N967K	probably damaging	Het
Sell	T	C	1: 164,063,062	W5R	probably benign	Het
Siglec1	C	T	2: 131,069,869	V1697M	probably benign	Het
Slc22a26	T	A	19: 7,791,054	I213L	probably benign	Het
Slc2a13	G	A	15: 91,412,212	P300S	probably benign	Het
Slco1a4	A	G	6: 141,815,505	Y461H	possibly damaging	Het
Slco3a1	G	C	7: 74,320,556	C434W	probably null	Het
Sp3	A	T	2: 72,938,289	V666D	probably benign	Het
Spidr	A	T	16: 16,118,942	W100R	possibly damaging	Het
Stk33	T	A	7: 109,327,595	M286L	probably damaging	Het
Sult1c2	T	A	17: 53,832,135	I183F	probably benign	Het
Svep1	G	T	4: 58,087,751	T1776K	probably benign	Het
Tesk2	A	G	4: 116,802,993	H436R	probably benign	Het
Tex2	T	C	11: 106,568,404	T67A	probably damaging	Het
Timm10	T	C	2: 84,829,848	S44P	possibly damaging	Het
Tmed11	C	A	5: 108,795,182		probably null	Het
Trim12c	G	A	7: 104,340,948	R441C	probably damaging	Het
Trmt2a	A	G	16: 18,252,929	K509E	probably damaging	Het
Upk3a	A	G	15: 85,019,423	T108A	probably benign	Het
Usp29	A	G	7: 6,962,159	M334V	probably benign	Het
Vash1	A	G	12: 86,680,142	D52G	probably benign	Het
Vmn2r14	T	G	5: 109,220,380	T249P	probably benign	Het
Vmn2r43	A	T	7: 8,244,849	F772I	probably damaging	Het
Vmn2r75	G	T	7: 86,171,579	S49Y	probably benign	Het
Xdh	T	C	17: 73,910,243	T677A	probably damaging	Het
Zan	A	G	5: 137,386,456	L5102P	unknown	Het
Zfp160	T	A	17: 21,020,081	S9T	probably benign	Het
Zfp273	A	T	13: 67,825,554	H267L	probably damaging	Het
Zfp97	T	A	17: 17,144,776	I179K	probably benign	Het
Zfp975	T	C	7: 42,662,292	Y299C	probably damaging	Het

Other mutations in Dnah11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Dnah11	APN	12	118198745	missense	probably benign	0.28
IGL00422:Dnah11	APN	12	118068096	missense	probably damaging	1.00
IGL00436:Dnah11	APN	12	118036459	missense	possibly damaging	0.56
IGL00540:Dnah11	APN	12	118186922	missense	probably benign	0.01
IGL00687:Dnah11	APN	12	117922004	splice site	probably benign
IGL00833:Dnah11	APN	12	118179580	missense	probably damaging	1.00
IGL00906:Dnah11	APN	12	117911202	missense	probably damaging	1.00
IGL00952:Dnah11	APN	12	118196651	missense	possibly damaging	0.56
IGL01111:Dnah11	APN	12	118142934	splice site	probably benign
IGL01121:Dnah11	APN	12	118050695	missense	probably benign	0.02
IGL01143:Dnah11	APN	12	118012740	missense	probably damaging	1.00
IGL01359:Dnah11	APN	12	117982999	missense	probably damaging	0.99
IGL01372:Dnah11	APN	12	118192399	missense	probably damaging	1.00
IGL01410:Dnah11	APN	12	118047256	nonsense	probably null
IGL01418:Dnah11	APN	12	117987482	nonsense	probably null
IGL01444:Dnah11	APN	12	118020232	missense	possibly damaging	0.91
IGL01606:Dnah11	APN	12	117983032	missense	probably benign	0.15
IGL01645:Dnah11	APN	12	118186998	missense	possibly damaging	0.90
IGL01932:Dnah11	APN	12	118192270	splice site	probably benign
IGL02104:Dnah11	APN	12	118192390	missense	probably benign
IGL02151:Dnah11	APN	12	118059888	splice site	probably benign
IGL02189:Dnah11	APN	12	118082579	missense	probably benign	0.00
IGL02417:Dnah11	APN	12	118057180	missense	probably damaging	1.00
IGL02421:Dnah11	APN	12	118186902	missense	probably damaging	1.00
IGL02444:Dnah11	APN	12	117975873	splice site	probably benign
IGL02474:Dnah11	APN	12	118027445	splice site	probably null
IGL02526:Dnah11	APN	12	118179618	missense	possibly damaging	0.70
IGL02887:Dnah11	APN	12	117911040	missense	probably damaging	1.00
IGL03011:Dnah11	APN	12	118012377	missense	probably benign	0.08
IGL03061:Dnah11	APN	12	117903121	missense	probably damaging	1.00
IGL03182:Dnah11	APN	12	118030291	missense	probably damaging	0.99
IGL03220:Dnah11	APN	12	118105985	missense	probably benign
IGL03238:Dnah11	APN	12	118109898	missense	probably damaging	1.00
IGL03493:Dnah11	APN	12	118012798	missense	probably benign	0.00
P0045:Dnah11	UTSW	12	118030327	missense	probably benign
R0009:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R0066:Dnah11	UTSW	12	118126886	missense	probably benign	0.05
R0172:Dnah11	UTSW	12	117987453	missense	probably damaging	1.00
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0208:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0230:Dnah11	UTSW	12	117983056	nonsense	probably null
R0270:Dnah11	UTSW	12	118041013	missense	probably damaging	1.00
R0311:Dnah11	UTSW	12	118127133	missense	probably benign	0.03
R0325:Dnah11	UTSW	12	118012339	missense	probably benign
R0370:Dnah11	UTSW	12	117995227	missense	probably benign
R0416:Dnah11	UTSW	12	117911058	missense	probably damaging	1.00
R0505:Dnah11	UTSW	12	118106510	missense	probably damaging	1.00
R0540:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0554:Dnah11	UTSW	12	117931178	missense	probably benign	0.01
R0607:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0620:Dnah11	UTSW	12	117987469	missense	probably damaging	1.00
R0635:Dnah11	UTSW	12	118007996	missense	probably damaging	1.00
R0755:Dnah11	UTSW	12	117954829	missense	possibly damaging	0.95
R0755:Dnah11	UTSW	12	118198625	missense	probably benign	0.17
R0789:Dnah11	UTSW	12	117911232	missense	probably damaging	1.00
R0833:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0835:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R0836:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0846:Dnah11	UTSW	12	117933850	missense	probably damaging	0.97
R0865:Dnah11	UTSW	12	118190844	nonsense	probably null
R0928:Dnah11	UTSW	12	118045562	missense	probably damaging	1.00
R0939:Dnah11	UTSW	12	118060407	missense	probably damaging	1.00
R1203:Dnah11	UTSW	12	117933812	missense	possibly damaging	0.81
R1394:Dnah11	UTSW	12	117972364	missense	possibly damaging	0.75
R1398:Dnah11	UTSW	12	118057106	nonsense	probably null
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1500:Dnah11	UTSW	12	118012829	splice site	probably null
R1535:Dnah11	UTSW	12	118018730	missense	probably damaging	1.00
R1539:Dnah11	UTSW	12	117931256	missense	probably benign	0.01
R1554:Dnah11	UTSW	12	118082499	missense	possibly damaging	0.92
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1615:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R1618:Dnah11	UTSW	12	118015465	missense	probably damaging	0.98
R1638:Dnah11	UTSW	12	118015419	missense	possibly damaging	0.81
R1659:Dnah11	UTSW	12	118120724	missense	possibly damaging	0.94
R1671:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1678:Dnah11	UTSW	12	117933845	missense	possibly damaging	0.50
R1699:Dnah11	UTSW	12	118190868	missense	probably damaging	1.00
R1712:Dnah11	UTSW	12	118196644	missense	probably benign	0.32
R1728:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1729:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1764:Dnah11	UTSW	12	118190825	missense	probably benign	0.31
R1780:Dnah11	UTSW	12	118027558	missense	probably damaging	1.00
R1789:Dnah11	UTSW	12	118038780	missense	probably damaging	0.99
R1800:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1863:Dnah11	UTSW	12	118063852	missense	possibly damaging	0.92
R1892:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R1907:Dnah11	UTSW	12	118127556	missense	possibly damaging	0.66
R1964:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R1967:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1997:Dnah11	UTSW	12	118082468	missense	possibly damaging	0.64
R2086:Dnah11	UTSW	12	118113871	missense	possibly damaging	0.82
R2092:Dnah11	UTSW	12	118012716	missense	possibly damaging	0.50
R2108:Dnah11	UTSW	12	118020353	missense	probably damaging	1.00
R2140:Dnah11	UTSW	12	118008810	missense	probably benign	0.01
R2261:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2261:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2262:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2262:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2263:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2263:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2328:Dnah11	UTSW	12	117886686	missense	probably damaging	0.98
R2352:Dnah11	UTSW	12	117928330	missense	probably damaging	1.00
R2410:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R2885:Dnah11	UTSW	12	117987427	nonsense	probably null
R3499:Dnah11	UTSW	12	117911023	missense	probably damaging	1.00
R3741:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3742:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3779:Dnah11	UTSW	12	118130713	splice site	probably benign
R3785:Dnah11	UTSW	12	118017602	missense	probably damaging	1.00
R3883:Dnah11	UTSW	12	117978453	splice site	probably benign
R4014:Dnah11	UTSW	12	117974914	missense	probably benign	0.16
R4043:Dnah11	UTSW	12	117879943	missense	probably damaging	1.00
R4072:Dnah11	UTSW	12	118106492	missense	probably damaging	1.00
R4073:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4074:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4076:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4201:Dnah11	UTSW	12	117966659	missense	possibly damaging	0.63
R4224:Dnah11	UTSW	12	118130892	missense	probably benign	0.06
R4233:Dnah11	UTSW	12	117916791	missense	probably damaging	1.00
R4358:Dnah11	UTSW	12	118125843	nonsense	probably null
R4430:Dnah11	UTSW	12	117983011	missense	probably benign	0.26
R4465:Dnah11	UTSW	12	117987451	missense	probably benign	0.09
R4489:Dnah11	UTSW	12	117916896	missense	probably benign	0.31
R4572:Dnah11	UTSW	12	118010125	missense	probably benign	0.00
R4574:Dnah11	UTSW	12	118012255	critical splice donor site	probably null
R4657:Dnah11	UTSW	12	118192427	missense	probably benign	0.02
R4709:Dnah11	UTSW	12	118018760	missense	probably benign	0.26
R4740:Dnah11	UTSW	12	118120544	missense	probably benign	0.28
R4803:Dnah11	UTSW	12	118127608	missense	possibly damaging	0.50
R4908:Dnah11	UTSW	12	118126883	missense	probably benign	0.37
R5018:Dnah11	UTSW	12	118130728	missense	probably benign	0.00
R5071:Dnah11	UTSW	12	118082453	nonsense	probably null
R5074:Dnah11	UTSW	12	118082453	nonsense	probably null
R5080:Dnah11	UTSW	12	118198830	start codon destroyed	probably null	0.01
R5097:Dnah11	UTSW	12	118017700	missense	probably damaging	1.00
R5131:Dnah11	UTSW	12	117954751	missense	probably damaging	1.00
R5215:Dnah11	UTSW	12	118157361	missense	probably benign	0.09
R5252:Dnah11	UTSW	12	118125941	missense	probably damaging	1.00
R5296:Dnah11	UTSW	12	117883416	missense	probably damaging	1.00
R5308:Dnah11	UTSW	12	118085680	missense	possibly damaging	0.60
R5368:Dnah11	UTSW	12	117954893	missense	probably damaging	1.00
R5383:Dnah11	UTSW	12	118085697	missense	probably damaging	0.99
R5499:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R5503:Dnah11	UTSW	12	117880451	critical splice donor site	probably null
R5546:Dnah11	UTSW	12	117975848	missense	possibly damaging	0.83
R5578:Dnah11	UTSW	12	118018802	missense	probably damaging	0.99
R5657:Dnah11	UTSW	12	117883617	missense	probably damaging	1.00
R5702:Dnah11	UTSW	12	118113907	missense	probably benign	0.04
R5706:Dnah11	UTSW	12	118023935	missense	probably damaging	1.00
R5727:Dnah11	UTSW	12	118127106	missense	probably damaging	1.00
R5737:Dnah11	UTSW	12	118192390	missense	probably benign
R5884:Dnah11	UTSW	12	118177534	missense	probably benign	0.00
R5900:Dnah11	UTSW	12	118082431	splice site	probably null
R5905:Dnah11	UTSW	12	117954924	missense	probably damaging	1.00
R5928:Dnah11	UTSW	12	117914636	splice site	probably null
R5973:Dnah11	UTSW	12	118110952	missense	probably benign	0.02
R6024:Dnah11	UTSW	12	118030272	missense	probably benign	0.34
R6056:Dnah11	UTSW	12	117928456	missense	probably benign	0.03
R6075:Dnah11	UTSW	12	118104851	missense	probably damaging	1.00
R6092:Dnah11	UTSW	12	117928456	missense	probably benign
R6191:Dnah11	UTSW	12	118190897	missense	probably benign
R6197:Dnah11	UTSW	12	118179747	missense	probably benign	0.03
R6262:Dnah11	UTSW	12	117931178	missense	probably damaging	0.98
R6321:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R6454:Dnah11	UTSW	12	117916855	missense	probably benign	0.01
R6614:Dnah11	UTSW	12	117886676	missense	possibly damaging	0.72
R6694:Dnah11	UTSW	12	118186882	splice site	probably null
R6712:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R6720:Dnah11	UTSW	12	118045646	missense	probably damaging	1.00
R6742:Dnah11	UTSW	12	118113894	missense	possibly damaging	0.82
R6806:Dnah11	UTSW	12	117987676	splice site	probably null
R6895:Dnah11	UTSW	12	117995191	missense	probably damaging	0.99
R6939:Dnah11	UTSW	12	118106562	missense	probably damaging	1.00
R6940:Dnah11	UTSW	12	118198768	missense	probably benign
R6945:Dnah11	UTSW	12	118060310	missense	probably damaging	1.00
R6958:Dnah11	UTSW	12	117933809	missense	probably damaging	1.00
R6970:Dnah11	UTSW	12	118108944	missense	probably benign	0.00
R6976:Dnah11	UTSW	12	118198643	missense	probably benign	0.16
R7000:Dnah11	UTSW	12	118017661	missense	probably damaging	1.00
R7011:Dnah11	UTSW	12	117922018	frame shift	probably null
R7101:Dnah11	UTSW	12	118068145	missense	probably benign
R7106:Dnah11	UTSW	12	117961149	missense	probably benign	0.15
R7203:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R7219:Dnah11	UTSW	12	118041095	missense	possibly damaging	0.95
R7219:Dnah11	UTSW	12	118126889	missense	probably benign	0.00
R7308:Dnah11	UTSW	12	117995275	missense	probably damaging	1.00
R7361:Dnah11	UTSW	12	118018742	missense	probably damaging	1.00
R7367:Dnah11	UTSW	12	117987442	missense	possibly damaging	0.59
R7399:Dnah11	UTSW	12	118027477	missense	probably benign	0.00
R7399:Dnah11	UTSW	12	118125785	missense	probably damaging	1.00
R7404:Dnah11	UTSW	12	118104808	missense	probably benign	0.36
R7473:Dnah11	UTSW	12	117903176	missense	probably benign	0.19
R7545:Dnah11	UTSW	12	117931204	missense	probably damaging	1.00
R7608:Dnah11	UTSW	12	118140770	splice site	probably null
R7625:Dnah11	UTSW	12	118196642	missense	probably benign
R7761:Dnah11	UTSW	12	118023913	missense	probably damaging	1.00
R7879:Dnah11	UTSW	12	118041009	missense	probably damaging	1.00
R7881:Dnah11	UTSW	12	117987502	missense	probably benign	0.04
R7904:Dnah11	UTSW	12	117903268	missense	possibly damaging	0.72
R8100:Dnah11	UTSW	12	117966633	missense	probably damaging	0.99
R8179:Dnah11	UTSW	12	117878549	missense	possibly damaging	0.90
R8192:Dnah11	UTSW	12	118012446	missense	probably benign
R8254:Dnah11	UTSW	12	117878524	missense	possibly damaging	0.89
R8268:Dnah11	UTSW	12	118027508	nonsense	probably null
R8272:Dnah11	UTSW	12	118111017	missense	probably benign	0.01
R8344:Dnah11	UTSW	12	118085731	missense	probably benign	0.00
R8515:Dnah11	UTSW	12	117975798	missense	probably damaging	1.00
R8528:Dnah11	UTSW	12	118008803	missense	probably damaging	0.96
R8557:Dnah11	UTSW	12	117878512	missense	probably benign
R8676:Dnah11	UTSW	12	118190804	missense	probably damaging	1.00
R8738:Dnah11	UTSW	12	118085649	critical splice donor site	probably null
R8773:Dnah11	UTSW	12	117995215	missense	possibly damaging	0.94
R8818:Dnah11	UTSW	12	117911029	missense	probably damaging	1.00
R8855:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8866:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8881:Dnah11	UTSW	12	118113912	missense	probably benign	0.00
R8881:Dnah11	UTSW	12	118126815	missense	probably benign	0.05
R8920:Dnah11	UTSW	12	118113939	missense	probably damaging	0.99
R8944:Dnah11	UTSW	12	118127646	missense	possibly damaging	0.63
R8945:Dnah11	UTSW	12	118023983	missense	probably benign	0.36
R8962:Dnah11	UTSW	12	117952538	missense	probably damaging	1.00
R8962:Dnah11	UTSW	12	117954895	missense	probably damaging	1.00
R9059:Dnah11	UTSW	12	118130843	missense	probably benign	0.00
R9155:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9162:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9164:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9171:Dnah11	UTSW	12	117931183	missense	probably damaging	0.99
R9186:Dnah11	UTSW	12	118190897	missense	probably benign
R9205:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9208:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9234:Dnah11	UTSW	12	117987360	missense	probably damaging	1.00
R9264:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R9290:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9291:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9315:Dnah11	UTSW	12	118179606	missense	probably benign	0.11
R9353:Dnah11	UTSW	12	118179699	missense	probably benign	0.00
R9375:Dnah11	UTSW	12	117920968	missense	possibly damaging	0.67
R9392:Dnah11	UTSW	12	118047320	nonsense	probably null
R9392:Dnah11	UTSW	12	118177555	missense	probably benign	0.00
R9433:Dnah11	UTSW	12	118012272	missense	probably damaging	1.00
R9511:Dnah11	UTSW	12	117914617	missense	probably damaging	1.00
R9526:Dnah11	UTSW	12	118186976	missense	probably damaging	0.98
R9566:Dnah11	UTSW	12	117974993	missense	possibly damaging	0.69
R9673:Dnah11	UTSW	12	118018778	missense	possibly damaging	0.91
R9705:Dnah11	UTSW	12	118131035	missense	probably damaging	1.00
R9716:Dnah11	UTSW	12	118060413	missense	probably damaging	0.99
R9746:Dnah11	UTSW	12	117878576	nonsense	probably null
R9764:Dnah11	UTSW	12	117920969	missense	probably benign	0.05
RF023:Dnah11	UTSW	12	117954850	missense	probably damaging	1.00
RF047:Dnah11	UTSW	12	118010083	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117895012	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117982969	missense	probably damaging	1.00
Z1176:Dnah11	UTSW	12	117931177	missense	possibly damaging	0.81
Z1176:Dnah11	UTSW	12	118127119	missense	probably benign	0.00
Z1176:Dnah11	UTSW	12	118130799	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTGATACAGAGATTGCGAAACTG -3'
(R):5'- AATGCTACCTTGCACCTTGC -3'

Sequencing Primer
(F):5'- TTGCGAAACTGAAAGTGGCTGAC -3'
(R):5'- TGCACCTTGCTGCCTGG -3'

Posted On

2016-03-17