Incidental Mutation 'R4896:Itga2'
ID377672
Institutional Source Beutler Lab
Gene Symbol Itga2
Ensembl Gene ENSMUSG00000015533
Gene Nameintegrin alpha 2
SynonymsVLA-2 receptor, alpha 2 subunit, DX5, CD49B
MMRRC Submission 042500-MU
Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4896 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114833081-114932100 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 114853766 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 918 (K918*)
Ref Sequence ENSEMBL: ENSMUSP00000053891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056117]
Predicted Effect probably null
Transcript: ENSMUST00000056117
AA Change: K918*
SMART Domains Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: K918*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Int_alpha 41 96 4.91e-4 SMART
VWA 169 359 2.42e-39 SMART
Blast:VWA 364 424 4e-26 BLAST
Int_alpha 430 481 2.59e-3 SMART
Int_alpha 484 541 3.5e-9 SMART
Int_alpha 547 602 3.11e-15 SMART
Int_alpha 611 669 2.52e-1 SMART
low complexity region 890 910 N/A INTRINSIC
transmembrane domain 1129 1151 N/A INTRINSIC
Pfam:Integrin_alpha 1152 1166 9e-7 PFAM
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Adamts10 T C 17: 33,528,896 V102A possibly damaging Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alg12 A T 15: 88,816,188 L15Q probably damaging Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Col7a1 T A 9: 108,957,277 V525E unknown Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Itga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Itga2 APN 13 114877625 missense probably damaging 0.99
IGL01481:Itga2 APN 13 114859632 missense possibly damaging 0.63
IGL01666:Itga2 APN 13 114837091 critical splice donor site probably null
IGL01730:Itga2 APN 13 114854411 splice site probably benign
IGL01965:Itga2 APN 13 114848064 splice site probably benign
IGL01987:Itga2 APN 13 114847946 nonsense probably null
IGL02334:Itga2 APN 13 114865309 critical splice donor site probably null
IGL02381:Itga2 APN 13 114856722 missense probably damaging 1.00
IGL02562:Itga2 APN 13 114836570 unclassified probably benign
IGL03191:Itga2 APN 13 114836484 unclassified probably benign
IGL03209:Itga2 APN 13 114880632 missense probably damaging 1.00
P0007:Itga2 UTSW 13 114866199 missense probably damaging 1.00
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0025:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0029:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0149:Itga2 UTSW 13 114836579 unclassified probably benign
R0152:Itga2 UTSW 13 114866314 missense probably benign 0.06
R0496:Itga2 UTSW 13 114853899 missense probably benign 0.00
R0502:Itga2 UTSW 13 114845856 missense probably benign 0.15
R0599:Itga2 UTSW 13 114856650 splice site probably benign
R0688:Itga2 UTSW 13 114839554 missense probably benign 0.00
R0704:Itga2 UTSW 13 114862375 missense possibly damaging 0.91
R0760:Itga2 UTSW 13 114859632 missense possibly damaging 0.63
R0811:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0812:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0836:Itga2 UTSW 13 114856679 missense probably damaging 0.99
R1196:Itga2 UTSW 13 114866155 critical splice donor site probably null
R1546:Itga2 UTSW 13 114849420 missense possibly damaging 0.63
R1639:Itga2 UTSW 13 114857296 missense probably benign 0.00
R1834:Itga2 UTSW 13 114856726 missense probably damaging 0.98
R1834:Itga2 UTSW 13 114856727 missense probably damaging 1.00
R2180:Itga2 UTSW 13 114849381 missense possibly damaging 0.67
R2190:Itga2 UTSW 13 114870605 missense probably benign 0.05
R2518:Itga2 UTSW 13 114881042 missense probably damaging 1.00
R3885:Itga2 UTSW 13 114869299 missense probably benign 0.35
R3962:Itga2 UTSW 13 114839518 missense probably damaging 0.99
R4094:Itga2 UTSW 13 114870625 missense probably benign 0.01
R4193:Itga2 UTSW 13 114886649 nonsense probably null
R4290:Itga2 UTSW 13 114866173 missense probably damaging 0.98
R4459:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4460:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4628:Itga2 UTSW 13 114877693 missense probably benign 0.03
R4655:Itga2 UTSW 13 114873269 missense probably benign 0.00
R4716:Itga2 UTSW 13 114857373 missense probably damaging 0.98
R5093:Itga2 UTSW 13 114856181 missense probably benign 0.00
R5488:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5489:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5743:Itga2 UTSW 13 114884506 missense probably damaging 1.00
R5767:Itga2 UTSW 13 114839570 missense possibly damaging 0.88
R5790:Itga2 UTSW 13 114868206 missense probably benign 0.02
R5923:Itga2 UTSW 13 114884519 missense probably benign 0.02
R6163:Itga2 UTSW 13 114866190 missense probably damaging 1.00
R6227:Itga2 UTSW 13 114839561 missense probably benign 0.30
R6278:Itga2 UTSW 13 114845888 missense probably benign 0.05
R6283:Itga2 UTSW 13 114869250 missense probably damaging 1.00
R6332:Itga2 UTSW 13 114843473 missense probably benign
R6510:Itga2 UTSW 13 114873280 missense probably damaging 1.00
R6742:Itga2 UTSW 13 114836525 missense possibly damaging 0.93
R6869:Itga2 UTSW 13 114875537 synonymous probably null
R7073:Itga2 UTSW 13 114859613 missense probably damaging 1.00
R7111:Itga2 UTSW 13 114900530 missense unknown
R7236:Itga2 UTSW 13 114877691 missense probably benign
R7269:Itga2 UTSW 13 114886689 nonsense probably null
R7296:Itga2 UTSW 13 114857394 splice site probably null
R7350:Itga2 UTSW 13 114837202 missense probably damaging 0.98
R7375:Itga2 UTSW 13 114869217 missense probably benign 0.06
R7501:Itga2 UTSW 13 114875559 missense probably damaging 1.00
R7687:Itga2 UTSW 13 114866260 missense probably damaging 1.00
R7766:Itga2 UTSW 13 114853891 missense probably benign
R7810:Itga2 UTSW 13 114866179 missense probably benign 0.15
R8038:Itga2 UTSW 13 114853755 missense probably damaging 1.00
Z1088:Itga2 UTSW 13 114857332 missense possibly damaging 0.46
Z1177:Itga2 UTSW 13 114853701 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCCACCCAAGCTTTCAGG -3'
(R):5'- ATGTCCTGTGTAGGTGACTTTTACC -3'

Sequencing Primer
(F):5'- CACCCAAGCTTTCAGGGGTAAAAAG -3'
(R):5'- GGTGACTTTTACCATTAACTTCGAC -3'
Posted On2016-03-17