Incidental Mutation 'R4896:Pi4ka'
ID377685
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 042500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4896 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17377169 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 122 (C122S)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
Predicted Effect probably damaging
Transcript: ENSMUST00000036161
AA Change: C122S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: C122S

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128938
Predicted Effect probably damaging
Transcript: ENSMUST00000154364
AA Change: C122S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: C122S

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect possibly damaging
Transcript: ENSMUST00000232232
AA Change: C122S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Adamts10 T C 17: 33,528,896 V102A possibly damaging Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alg12 A T 15: 88,816,188 L15Q probably damaging Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Col7a1 T A 9: 108,957,277 V525E unknown Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Itga2 T A 13: 114,853,766 K918* probably null Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACAGACAGTTAGCAGGTTG -3'
(R):5'- TGCTGTGACACCAGTAATGG -3'

Sequencing Primer
(F):5'- TGCTGGGCAGGATGGAGC -3'
(R):5'- GTGACACCAGTAATGGCATATTAAAG -3'
Posted On2016-03-17