Incidental Mutation 'R4896:Xdh'
ID 377695
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 042500-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R4896 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74217238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 677 (T677A)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: T677A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: T677A

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.6924 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,957,267 (GRCm39) V132A possibly damaging Het
Acp3 A T 9: 104,184,174 (GRCm39) V292E probably damaging Het
Adamts10 T C 17: 33,747,870 (GRCm39) V102A possibly damaging Het
Add2 A G 6: 86,073,728 (GRCm39) T206A probably benign Het
Alg12 A T 15: 88,700,391 (GRCm39) L15Q probably damaging Het
Ankrd27 T A 7: 35,307,800 (GRCm39) D346E probably damaging Het
Armc2 A T 10: 41,799,790 (GRCm39) N689K probably damaging Het
Best3 T A 10: 116,860,460 (GRCm39) D573E probably benign Het
Bltp1 T G 3: 37,020,086 (GRCm39) N2108K probably damaging Het
Ccdc80 A T 16: 44,916,261 (GRCm39) Q339L probably benign Het
Cdh9 T C 15: 16,778,242 (GRCm39) V19A probably benign Het
Cimap1a G A 7: 140,428,398 (GRCm39) probably benign Het
Cnksr1 A T 4: 133,956,986 (GRCm39) probably null Het
Col7a1 T A 9: 108,786,345 (GRCm39) V525E unknown Het
Cplane1 T C 15: 8,251,421 (GRCm39) S1898P probably benign Het
Crebrf T C 17: 26,961,394 (GRCm39) S172P possibly damaging Het
Csmd1 T C 8: 16,059,439 (GRCm39) I2099V probably benign Het
Dcaf4 T A 12: 83,586,233 (GRCm39) M400K possibly damaging Het
Dnah11 A T 12: 117,958,935 (GRCm39) F2983I probably damaging Het
Dock6 A G 9: 21,735,733 (GRCm39) V1005A possibly damaging Het
Dyrk2 C A 10: 118,704,153 (GRCm39) G34C probably damaging Het
Eif4a1 A T 11: 69,559,423 (GRCm39) probably benign Het
Eno4 G T 19: 58,952,975 (GRCm39) D330Y probably damaging Het
Faf1 G A 4: 109,699,496 (GRCm39) C347Y probably benign Het
Fam169a A G 13: 97,234,100 (GRCm39) Y124C probably damaging Het
Fam227a G T 15: 79,521,255 (GRCm39) F269L probably benign Het
Fancm C A 12: 65,122,605 (GRCm39) D42E probably damaging Het
Fat1 T A 8: 45,404,317 (GRCm39) I356N possibly damaging Het
Fer1l6 A T 15: 58,509,869 (GRCm39) T1444S probably damaging Het
Galr1 A G 18: 82,412,065 (GRCm39) L267P probably damaging Het
Gbx1 T C 5: 24,709,837 (GRCm39) H336R probably damaging Het
Gimap8 A T 6: 48,636,281 (GRCm39) Q682L possibly damaging Het
Gm2396 T G 9: 88,813,281 (GRCm39) noncoding transcript Het
Gm5798 T C 14: 41,070,614 (GRCm39) L8S probably damaging Het
Hmgcll1 C T 9: 75,963,460 (GRCm39) S39F possibly damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Il3ra A T 14: 14,355,381 (GRCm38) E289D probably benign Het
Isoc1 T A 18: 58,806,350 (GRCm39) L220Q probably damaging Het
Itga2 T A 13: 114,990,302 (GRCm39) K918* probably null Het
Kat6a C T 8: 23,428,329 (GRCm39) T1228I probably benign Het
Klhl30 T A 1: 91,287,046 (GRCm39) probably null Het
Krtap6-2 A T 16: 89,216,806 (GRCm39) C54S unknown Het
Lmf2 G A 15: 89,236,003 (GRCm39) P634S probably benign Het
Map3k4 A G 17: 12,490,906 (GRCm39) V175A possibly damaging Het
Mcm3 A C 1: 20,890,480 (GRCm39) probably benign Het
Mon1b T C 8: 114,365,859 (GRCm39) S396P probably damaging Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Ncor2 A G 5: 125,126,404 (GRCm39) probably null Het
Nlrc5 T G 8: 95,247,844 (GRCm39) probably benign Het
Nlrp14 GT GTT 7: 106,796,386 (GRCm39) probably null Het
Nwd2 T G 5: 63,962,151 (GRCm39) S578R probably damaging Het
Or12k7 A G 2: 36,958,422 (GRCm39) Y35C probably damaging Het
Or4f4b G A 2: 111,314,005 (GRCm39) V105I possibly damaging Het
Otoa C A 7: 120,701,902 (GRCm39) P194T probably damaging Het
Pde1b A C 15: 103,429,801 (GRCm39) D98A probably damaging Het
Pi4ka A T 16: 17,195,033 (GRCm39) C122S probably damaging Het
Pole2 C T 12: 69,269,924 (GRCm39) V67M probably damaging Het
Prickle2 A T 6: 92,393,736 (GRCm39) D312E probably benign Het
Prkd1 T C 12: 50,436,745 (GRCm39) D453G probably damaging Het
Prrc1 T A 18: 57,507,626 (GRCm39) V260E probably damaging Het
Reg3g A T 6: 78,444,793 (GRCm39) Y62N probably benign Het
Reln C T 5: 22,160,236 (GRCm39) G2111E probably damaging Het
Rsph6a A T 7: 18,791,665 (GRCm39) E278V possibly damaging Het
Scpep1 T A 11: 88,832,122 (GRCm39) I203F probably damaging Het
Sec24d T C 3: 123,148,596 (GRCm39) C747R probably damaging Het
Sec31a A T 5: 100,516,192 (GRCm39) N967K probably damaging Het
Sell T C 1: 163,890,631 (GRCm39) W5R probably benign Het
Siglec1 C T 2: 130,911,789 (GRCm39) V1697M probably benign Het
Sinhcaf A G 6: 148,834,498 (GRCm39) probably null Het
Slc22a26 T A 19: 7,768,419 (GRCm39) I213L probably benign Het
Slc2a13 G A 15: 91,296,415 (GRCm39) P300S probably benign Het
Slco1a4 A G 6: 141,761,231 (GRCm39) Y461H possibly damaging Het
Slco3a1 G C 7: 73,970,304 (GRCm39) C434W probably null Het
Sp3 A T 2: 72,768,633 (GRCm39) V666D probably benign Het
Spidr A T 16: 15,936,806 (GRCm39) W100R possibly damaging Het
Stk33 T A 7: 108,926,802 (GRCm39) M286L probably damaging Het
Sult1c2 T A 17: 54,139,163 (GRCm39) I183F probably benign Het
Svep1 G T 4: 58,087,751 (GRCm39) T1776K probably benign Het
Tesk2 A G 4: 116,660,190 (GRCm39) H436R probably benign Het
Tex2 T C 11: 106,459,230 (GRCm39) T67A probably damaging Het
Timm10 T C 2: 84,660,192 (GRCm39) S44P possibly damaging Het
Tmed11 C A 5: 108,943,048 (GRCm39) probably null Het
Trim12c G A 7: 103,990,155 (GRCm39) R441C probably damaging Het
Trmt2a A G 16: 18,070,793 (GRCm39) K509E probably damaging Het
Upk3a A G 15: 84,903,624 (GRCm39) T108A probably benign Het
Usp29 A G 7: 6,965,158 (GRCm39) M334V probably benign Het
Vash1 A G 12: 86,726,916 (GRCm39) D52G probably benign Het
Vmn2r14 T G 5: 109,368,246 (GRCm39) T249P probably benign Het
Vmn2r43 A T 7: 8,247,848 (GRCm39) F772I probably damaging Het
Vmn2r75 G T 7: 85,820,787 (GRCm39) S49Y probably benign Het
Zan A G 5: 137,384,718 (GRCm39) L5102P unknown Het
Zfp160 T A 17: 21,240,343 (GRCm39) S9T probably benign Het
Zfp273 A T 13: 67,973,673 (GRCm39) H267L probably damaging Het
Zfp97 T A 17: 17,365,038 (GRCm39) I179K probably benign Het
Zfp975 T C 7: 42,311,716 (GRCm39) Y299C probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTTGGAGGGTCATTCTC -3'
(R):5'- TCCTGGCACACTGATGCTAAG -3'

Sequencing Primer
(F):5'- GGTCATTCTCCAGAGGATTCAAAG -3'
(R):5'- GCACACTGATGCTAAGTTCTTG -3'
Posted On 2016-03-17