Incidental Mutation 'R4449:Gm10722'
ID377706
Institutional Source Beutler Lab
Gene Symbol Gm10722
Ensembl Gene ENSMUSG00000091028
Gene Namepredicted gene 10722
Synonyms
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R4449 (G1)
Quality Score20
Status Validated
Chromosome9
Chromosomal Location3000922-3002330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3001041 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 39 (Y39S)
Ref Sequence ENSEMBL: ENSMUSP00000132394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151376] [ENSMUST00000177722] [ENSMUST00000178077] [ENSMUST00000178348] [ENSMUST00000179881]
Predicted Effect probably benign
Transcript: ENSMUST00000151376
AA Change: Y39S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132394
Gene: ENSMUSG00000091028
AA Change: Y39S

DomainStartEndE-ValueType
internal_repeat_2 8 50 1.25e-5 PROSPERO
internal_repeat_1 11 88 6.98e-39 PROSPERO
internal_repeat_2 66 108 1.25e-5 PROSPERO
internal_repeat_1 89 166 6.98e-39 PROSPERO
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177722
SMART Domains Protein: ENSMUSP00000136598
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.14e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 1.14e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178077
SMART Domains Protein: ENSMUSP00000136761
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 4.71e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 4.71e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178348
SMART Domains Protein: ENSMUSP00000137273
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 48 1.34e-9 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 1.34e-9 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179881
SMART Domains Protein: ENSMUSP00000136541
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 46 5.29e-7 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 182 5.29e-7 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181242
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Gm10722
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Gm10722 APN 9 3002230 missense probably damaging 0.98
PIT4131001:Gm10722 UTSW 9 3001414 unclassified probably benign
PIT4142001:Gm10722 UTSW 9 3001350 missense probably benign
R0148:Gm10722 UTSW 9 3001405 missense probably null
R0335:Gm10722 UTSW 9 3001048 missense probably null
R4162:Gm10722 UTSW 9 3001041 missense probably benign
R4327:Gm10722 UTSW 9 3000937 missense probably benign
R4516:Gm10722 UTSW 9 3000937 missense probably benign
R4807:Gm10722 UTSW 9 3000937 missense probably benign
R4998:Gm10722 UTSW 9 3001041 missense probably benign
R5017:Gm10722 UTSW 9 3000937 missense probably benign
R5021:Gm10722 UTSW 9 3001041 missense probably benign
R5075:Gm10722 UTSW 9 3001041 missense probably benign
R5135:Gm10722 UTSW 9 3000937 missense probably benign
R5152:Gm10722 UTSW 9 3001041 missense probably benign
R5226:Gm10722 UTSW 9 3000937 missense probably benign
R5482:Gm10722 UTSW 9 3001041 missense probably benign
R7381:Gm10722 UTSW 9 3001235 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGTCTTACAGGGTGCATTTC -3'
(R):5'- CACTTTAGGACATGAAATATGGCGA -3'

Sequencing Primer
(F):5'- GCCATATTTCAGGTCCTACAGTGTG -3'
(R):5'- CATGAAATATGGCGAGGAAAACTG -3'
Posted On2016-03-21