Mutagenetix > Incidental Mutations

Incidental Mutation 'R4283:Ptpn21'

377715

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

041651-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R4283 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98733475 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 60 (E60G)

Ref Sequence

ENSEMBL: ENSMUSP00000152695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085116
AA Change: E60G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: E60G

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170188
AA Change: E60G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: E60G

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000221148
AA Change: E60G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221535
AA Change: E60G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221932
AA Change: E60G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222071

Meta Mutation Damage Score

0.5294

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030468B19Rik	A	G	11: 117,806,261	T229A	probably benign	Het
Adgrg5	T	G	8: 94,937,698	V312G	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Camk2b	A	C	11: 5,987,099	S327A	probably benign	Het
Card9	A	G	2: 26,357,297	I280T	possibly damaging	Het
Cd274	A	T	19: 29,380,471	M188L	probably benign	Het
Cga	T	C	4: 34,905,264		probably null	Het
Copg1	C	T	6: 87,908,545	T723M	probably damaging	Het
Cplx2	A	G	13: 54,379,564	E87G	probably damaging	Het
Crtc2	A	G	3: 90,259,236		probably benign	Het
Defa27	A	G	8: 21,315,616	N24S	probably benign	Het
Defb40	A	G	8: 18,978,077	S14P	probably damaging	Het
Dnmt3a	G	A	12: 3,901,665	G681R	probably damaging	Het
Ghr	C	A	15: 3,333,448	V181L	possibly damaging	Het
Gm10750	A	G	2: 149,015,996	F112L	unknown	Het
Gm17541	A	G	12: 4,689,656		probably benign	Het
Gmip	T	A	8: 69,813,601		probably benign	Het
Hdac10	A	G	15: 89,125,623	L402P	possibly damaging	Het
Hsd17b12	G	C	2: 94,033,586	R304G	unknown	Het
Iqgap3	T	C	3: 88,098,860	V526A	probably benign	Het
Ncaph	A	G	2: 127,121,085		probably benign	Het
Ninl	T	C	2: 150,953,416		probably benign	Het
Pcgf1	T	A	6: 83,079,733	L90Q	probably damaging	Het
Pcsk4	C	A	10: 80,329,453		probably benign	Het
Rec8	A	G	14: 55,618,634	H11R	probably damaging	Het
Ric1	A	G	19: 29,586,550	Y568C	probably damaging	Het
Slc17a6	A	G	7: 51,645,076	Y177C	probably damaging	Het
Tas2r104	C	T	6: 131,685,411	A112T	probably damaging	Het
Tas2r123	G	A	6: 132,848,045	V302I	possibly damaging	Het
Tas2r143	T	A	6: 42,401,073		probably null	Het
Tfeb	A	G	17: 47,789,774	E305G	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Upf2	A	G	2: 5,973,558	N411S	unknown	Het
Vmn2r52	C	T	7: 10,170,638	G425R	possibly damaging	Het
Zfp28	A	T	7: 6,393,701	Q378H	probably benign	Het
Zfp429	A	C	13: 67,390,795	C177G	probably damaging	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98688590	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	unclassified	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98688248	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98708844	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98715117	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98689076	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98688772	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98682532	missense	probably damaging	1.00
R7867:Ptpn21	UTSW	12	98705176	missense	probably damaging	1.00
R7878:Ptpn21	UTSW	12	98715128	missense	probably damaging	1.00
R7911:Ptpn21	UTSW	12	98688842	missense	probably damaging	0.99
R7950:Ptpn21	UTSW	12	98705176	missense	probably damaging	1.00
R7961:Ptpn21	UTSW	12	98715128	missense	probably damaging	1.00
R7992:Ptpn21	UTSW	12	98688842	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGCCTTTATGAGGGACATAGG -3'
(R):5'- TGCCACTGCCATTTGGATTG -3'

Sequencing Primer
(F):5'- TTTTTGGAGCACCCCCAGAG -3'
(R):5'- GCCACTGCCATTTGGATTGAAATTG -3'

Posted On

2016-03-22