Incidental Mutation 'R4283:Ptpn21'
ID377715
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission 041651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4283 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98733475 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 60 (E60G)
Ref Sequence ENSEMBL: ENSMUSP00000152695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085116
AA Change: E60G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: E60G

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170188
AA Change: E60G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: E60G

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221148
AA Change: E60G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221535
AA Change: E60G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000221932
AA Change: E60G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222071
Meta Mutation Damage Score 0.5294 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,261 T229A probably benign Het
Adgrg5 T G 8: 94,937,698 V312G probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Camk2b A C 11: 5,987,099 S327A probably benign Het
Card9 A G 2: 26,357,297 I280T possibly damaging Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cga T C 4: 34,905,264 probably null Het
Copg1 C T 6: 87,908,545 T723M probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Crtc2 A G 3: 90,259,236 probably benign Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Ghr C A 15: 3,333,448 V181L possibly damaging Het
Gm10750 A G 2: 149,015,996 F112L unknown Het
Gm17541 A G 12: 4,689,656 probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hdac10 A G 15: 89,125,623 L402P possibly damaging Het
Hsd17b12 G C 2: 94,033,586 R304G unknown Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Ncaph A G 2: 127,121,085 probably benign Het
Ninl T C 2: 150,953,416 probably benign Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pcsk4 C A 10: 80,329,453 probably benign Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Slc17a6 A G 7: 51,645,076 Y177C probably damaging Het
Tas2r104 C T 6: 131,685,411 A112T probably damaging Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tas2r143 T A 6: 42,401,073 probably null Het
Tfeb A G 17: 47,789,774 E305G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Upf2 A G 2: 5,973,558 N411S unknown Het
Vmn2r52 C T 7: 10,170,638 G425R possibly damaging Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7327:Ptpn21 UTSW 12 98680101 missense probably damaging 1.00
R7474:Ptpn21 UTSW 12 98737363 critical splice donor site probably null
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
R7867:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7878:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7911:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
R7950:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7961:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7992:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGCCTTTATGAGGGACATAGG -3'
(R):5'- TGCCACTGCCATTTGGATTG -3'

Sequencing Primer
(F):5'- TTTTTGGAGCACCCCCAGAG -3'
(R):5'- GCCACTGCCATTTGGATTGAAATTG -3'
Posted On2016-03-22