Incidental Mutation 'R4479:Ighv1-22'
ID377723
Institutional Source Beutler Lab
Gene Symbol Ighv1-22
Ensembl Gene ENSMUSG00000094561
Gene Nameimmunoglobulin heavy variable 1-22
SynonymsGm16860
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location114746273-114746706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114746663 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 15 (A15E)
Ref Sequence ENSEMBL: ENSMUSP00000100288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103507
AA Change: A15E

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100288
Gene: ENSMUSG00000094561
AA Change: A15E

DomainStartEndE-ValueType
IGv 36 117 9.01e-29 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Ighv1-22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Ighv1-22 APN 12 114746678 missense probably damaging 1.00
IGL02584:Ighv1-22 APN 12 114746322 missense probably benign 0.00
R2858:Ighv1-22 UTSW 12 114746298 missense probably damaging 1.00
R3849:Ighv1-22 UTSW 12 114746681 missense possibly damaging 0.89
R4667:Ighv1-22 UTSW 12 114746451 missense probably damaging 0.96
R4874:Ighv1-22 UTSW 12 114746416 missense probably benign 0.07
R5151:Ighv1-22 UTSW 12 114746308 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCAAGGCTCTTTCCATGGC -3'
(R):5'- TCCCCTGGTCATGAATATGC -3'

Sequencing Primer
(F):5'- GAATGTGTATCCAGAAGCCTTGC -3'
(R):5'- CCCCTGGTCATGAATATGCAAATTAC -3'
Posted On2016-03-24