Incidental Mutation 'R4505:Sp110'
ID377728
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R4505 (G1)
Quality Score23
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85589173 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 201 (Q201P)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000093508
AA Change: Q201P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: Q201P

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,333,695 I1367N probably damaging Het
Acbd4 A G 11: 103,104,779 probably benign Het
Adarb2 A T 13: 8,697,691 S428C probably damaging Het
Atl3 T A 19: 7,520,819 D193E probably benign Het
Bhlhe22 T C 3: 18,054,959 S58P probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Epha10 A G 4: 124,915,687 probably benign Het
Farp2 A T 1: 93,619,010 N917I probably damaging Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Fras1 T A 5: 96,781,348 N3870K probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr20 T C 15: 73,696,472 T23A probably benign Het
Grb14 A C 2: 65,022,568 V26G probably damaging Het
Itgb4 G A 11: 115,983,261 silent Het
Jak1 T C 4: 101,154,603 T1101A probably benign Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Lrig3 C T 10: 126,013,347 P979S probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Map4 T C 9: 110,032,185 S206P probably benign Het
Mon2 A G 10: 123,009,589 S1405P probably damaging Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr486 T C 7: 108,171,968 I259V probably benign Het
Pithd1 T C 4: 135,978,833 N37S probably benign Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Prb1 T A 6: 132,207,570 R367* probably null Het
Psmb4 A C 3: 94,886,145 Y142D probably damaging Het
Ptprs T C 17: 56,451,678 N181S possibly damaging Het
Rcbtb2 T C 14: 73,173,905 L370P probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Runx1t1 G T 4: 13,889,676 C535F probably damaging Het
Samd4b A G 7: 28,407,500 M329T probably benign Het
Serpinb9g T A 13: 33,486,563 F11L probably damaging Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Tjp2 T C 19: 24,108,831 T776A possibly damaging Het
Tmc1 C T 19: 20,868,374 V162I probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Ush2a A G 1: 188,728,596 T2685A possibly damaging Het
Vmn2r102 C T 17: 19,660,583 T62I probably benign Het
Vps13c A T 9: 67,939,034 Q2128L probably benign Het
Zfp26 T C 9: 20,442,265 E76G probably benign Het
Zfp28 T C 7: 6,394,161 S532P probably damaging Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCTTTGACAACTGAAGGAGGAAG -3'
(R):5'- CATTGCGTTCCAGAGTTGGG -3'

Sequencing Primer
(F):5'- GGAAAGGGTTGGGTTACTGAACTG -3'
(R):5'- AGTATGGACTCAGTAACTTTTCCTC -3'
Posted On2016-03-25