Incidental Mutation 'R4362:Gins1'
ID377729
Institutional Source Beutler Lab
Gene Symbol Gins1
Ensembl Gene ENSMUSG00000027454
Gene NameGINS complex subunit 1 (Psf1 homolog)
SynonymsPsf1, 2810418N01Rik
MMRRC Submission 041671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4362 (G1)
Quality Score30
Status Validated
Chromosome2
Chromosomal Location150905400-150931280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150909762 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 15 (R15H)
Ref Sequence ENSEMBL: ENSMUSP00000028948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028948]
Predicted Effect probably damaging
Transcript: ENSMUST00000028948
AA Change: R15H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454
AA Change: R15H

DomainStartEndE-ValueType
PDB:2Q9Q|G 1 196 1e-141 PDB
Blast:KISc 112 188 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152991
Meta Mutation Damage Score 0.5453 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele display disorganized embryonic and extraembryonic structures and fail to develop past E5.5; mutant blastocysts fail to exhibit outgrowth in culture and show a cell proliferation defect and inner cell mass apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik C T 7: 29,248,262 probably benign Het
2410089E03Rik T A 15: 8,270,745 S3179T unknown Het
Abcc6 A G 7: 45,998,832 probably benign Het
Adamts13 G A 2: 27,004,782 C1034Y probably damaging Het
Atp2b4 G T 1: 133,739,931 P125Q possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Bicc1 ATGTG ATG 10: 70,943,374 probably null Het
Cap1 G A 4: 122,862,987 P302S probably benign Het
Chodl G T 16: 78,944,658 probably null Het
Cplx2 A T 13: 54,378,817 T13S probably benign Het
Dennd5a G A 7: 109,896,343 R1194W probably damaging Het
Dsc2 T A 18: 20,050,157 D68V probably damaging Het
Dus4l A C 12: 31,648,828 I59R probably damaging Het
Edc3 C T 9: 57,713,546 P50L probably damaging Het
Ext1 G A 15: 53,107,591 probably benign Het
Fam105a C T 15: 27,664,343 probably null Het
Fam219a C T 4: 41,518,844 probably benign Het
Fbxl3 A T 14: 103,092,313 D106E probably damaging Het
Garem1 T C 18: 21,236,115 N50D possibly damaging Het
Glrx2 A G 1: 143,741,680 K44R possibly damaging Het
Icam1 A G 9: 21,026,312 D215G possibly damaging Het
Nedd9 A T 13: 41,317,953 I184N probably damaging Het
Olfr380 T C 11: 73,453,565 M216V probably benign Het
Olfr714 T C 7: 107,074,592 S255P probably damaging Het
Ppp1r32 T C 19: 10,475,021 Y375C probably damaging Het
Rhot2 A G 17: 25,842,091 C147R probably damaging Het
Setd4 T C 16: 93,583,686 probably null Het
Slc6a4 A G 11: 77,017,078 N356S probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tmem168 A C 6: 13,595,073 I381S probably benign Het
Tnfrsf11b T A 15: 54,256,159 T140S possibly damaging Het
Ttpa G T 4: 20,023,827 E130* probably null Het
Ubr5 A G 15: 38,078,403 V8A probably damaging Het
Vmn2r18 C T 5: 151,572,903 C450Y probably damaging Het
Vmn2r32 A T 7: 7,479,858 L39* probably null Het
Other mutations in Gins1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1352:Gins1 UTSW 2 150930848 nonsense probably null
R1575:Gins1 UTSW 2 150912838 missense probably benign
R4361:Gins1 UTSW 2 150925901 missense probably damaging 1.00
R4618:Gins1 UTSW 2 150917861 splice site probably null
R5769:Gins1 UTSW 2 150925998 missense probably damaging 0.99
R6642:Gins1 UTSW 2 150928118 critical splice donor site probably null
R6700:Gins1 UTSW 2 150916228 missense probably damaging 1.00
R7038:Gins1 UTSW 2 150917871 missense probably damaging 1.00
R7072:Gins1 UTSW 2 150909751 synonymous probably null
R7325:Gins1 UTSW 2 150916166 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACTTCTATTGGTTGAGCC -3'
(R):5'- TTGGCCCCGTTTCAAACTTG -3'

Sequencing Primer
(F):5'- CACTTCTATTGGTTGAGCCTATTTG -3'
(R):5'- AAGCAACAGCAGGCATAGGCTCCGC -3'
Posted On2016-03-25