Incidental Mutation 'R4307:Gm20939'
ID377732
Institutional Source Beutler Lab
Gene Symbol Gm20939
Ensembl Gene ENSMUSG00000095193
Gene Namepredicted gene, 20939
Synonyms
MMRRC Submission 041658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4307 (G1)
Quality Score40
Status Validated
Chromosome17
Chromosomal Location94873986-94877497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94876734 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 270 (Y270F)
Ref Sequence ENSEMBL: ENSMUSP00000103642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108007
AA Change: Y270F

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103642
Gene: ENSMUSG00000095193
AA Change: Y270F

DomainStartEndE-ValueType
KRAB 3 65 7.59e-15 SMART
ZnF_C2H2 130 152 5.21e-4 SMART
ZnF_C2H2 158 180 1.18e-2 SMART
ZnF_C2H2 186 208 2.12e-4 SMART
ZnF_C2H2 214 236 2.57e-3 SMART
ZnF_C2H2 242 264 1.3e-4 SMART
ZnF_C2H2 270 292 2.99e-4 SMART
ZnF_C2H2 298 320 7.9e-4 SMART
ZnF_C2H2 326 348 1.6e-4 SMART
ZnF_C2H2 354 376 4.24e-4 SMART
ZnF_C2H2 382 404 2.79e-4 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 1.22e-4 SMART
ZnF_C2H2 466 488 4.17e-3 SMART
ZnF_C2H2 494 516 1.6e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik A C 10: 83,737,928 K22N probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Efemp2 T A 19: 5,481,621 Y430N possibly damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gpbp1 T C 13: 111,448,983 *68W probably null Het
Gpm6a T C 8: 55,047,393 probably null Het
Inpp5a T C 7: 139,574,963 S333P possibly damaging Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Kif27 C T 13: 58,344,123 V401I probably benign Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r28 A T 7: 5,490,708 F80I probably damaging Het
Other mutations in Gm20939
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Gm20939 APN 17 94874293 splice site probably benign
R0015:Gm20939 UTSW 17 94876768 missense probably benign 0.00
R1563:Gm20939 UTSW 17 94877094 missense probably damaging 1.00
R1714:Gm20939 UTSW 17 94875806 missense probably damaging 1.00
R2029:Gm20939 UTSW 17 94875824 splice site probably benign
R2922:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R2923:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3158:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3810:Gm20939 UTSW 17 94876710 missense possibly damaging 0.46
R4158:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R4304:Gm20939 UTSW 17 94877281 missense probably benign
R5080:Gm20939 UTSW 17 94876991 missense probably damaging 1.00
R5271:Gm20939 UTSW 17 94877155 nonsense probably null
R5661:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R5771:Gm20939 UTSW 17 94874339 missense possibly damaging 0.93
R6800:Gm20939 UTSW 17 94877229 missense possibly damaging 0.75
R8393:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R8791:Gm20939 UTSW 17 94877220 missense probably damaging 1.00
Z1088:Gm20939 UTSW 17 94877433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGTCTCCAAGCACATAAAGTAAC -3'
(R):5'- CTGAGATGACTGTGTCGTCCAA -3'

Sequencing Primer
(F):5'- TCTCATGGTCAACTTCAAGCACATG -3'
(R):5'- GACTGTGTCGTCCAAAGACTTTAC -3'
Posted On2016-03-25