Incidental Mutation 'R4327:Arhgef12'
ID 377751
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene Name Rho guanine nucleotide exchange factor 12
Synonyms 2310014B11Rik, LARG
MMRRC Submission 041097-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R4327 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 42875138-43017069 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 42886525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1152 (E1152*)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
AlphaFold Q8R4H2
Predicted Effect probably null
Transcript: ENSMUST00000072767
AA Change: E1151*
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: E1151*

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165665
AA Change: E1152*
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: E1152*

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,221,664 (GRCm39) D55G possibly damaging Het
Alcam T C 16: 52,073,579 (GRCm39) N549S possibly damaging Het
Arap2 A T 5: 62,779,206 (GRCm39) H1461Q possibly damaging Het
Arrdc5 T C 17: 56,601,420 (GRCm39) E235G possibly damaging Het
Atp1a3 A G 7: 24,687,056 (GRCm39) probably benign Het
Bcl2l1 A G 2: 152,624,099 (GRCm39) V223A probably benign Het
C9orf72 T A 4: 35,225,985 (GRCm39) probably benign Het
Cela3b G T 4: 137,151,242 (GRCm39) A137E probably benign Het
Col13a1 T C 10: 61,699,758 (GRCm39) T476A unknown Het
Col16a1 T C 4: 129,988,344 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,299 (GRCm39) probably benign Het
Cyp2j8 T A 4: 96,395,566 (GRCm39) T20S probably benign Het
Fastkd2 A G 1: 63,791,516 (GRCm39) K675E probably benign Het
Fsip2 A T 2: 82,817,403 (GRCm39) I4379F probably benign Het
Gm10722 T C 9: 3,000,937 (GRCm39) C6R probably benign Het
Hmgxb3 A T 18: 61,300,611 (GRCm39) M155K probably benign Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kcnn1 A T 8: 71,305,307 (GRCm39) V301E probably damaging Het
Kcnq4 T C 4: 120,568,561 (GRCm39) E385G probably benign Het
Klhl28 G A 12: 64,996,952 (GRCm39) A463V probably damaging Het
Lhb A G 7: 45,070,383 (GRCm39) R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 (GRCm39) D506V probably damaging Het
Macf1 C T 4: 123,276,005 (GRCm39) A4176T probably damaging Het
Marchf6 C T 15: 31,498,887 (GRCm39) E137K probably benign Het
Med12l T C 3: 59,172,688 (GRCm39) S1813P probably benign Het
Mpp3 T C 11: 101,914,337 (GRCm39) probably benign Het
Muc2 A C 7: 141,281,577 (GRCm39) S479R probably damaging Het
Or11g27 T A 14: 50,770,971 (GRCm39) I34N probably benign Het
Or12e10 G T 2: 87,640,496 (GRCm39) V111L probably benign Het
Or2t1 T A 14: 14,328,193 (GRCm38) F27L probably damaging Het
Or52n1 G A 7: 104,382,833 (GRCm39) T246I probably damaging Het
Pafah1b1 T C 11: 74,573,066 (GRCm39) T333A probably benign Het
Palm G A 10: 79,643,520 (GRCm39) G83S probably benign Het
Pcdhb9 A T 18: 37,534,875 (GRCm39) S290C probably benign Het
Pcdhb9 G T 18: 37,534,876 (GRCm39) S290I probably benign Het
Pdgfrb A T 18: 61,204,792 (GRCm39) I551F possibly damaging Het
Pex26 A T 6: 121,164,373 (GRCm39) E172V probably damaging Het
Pitrm1 A G 13: 6,629,809 (GRCm39) probably benign Het
Ptprs C A 17: 56,754,468 (GRCm39) A191S possibly damaging Het
Rdm1 T A 11: 101,521,734 (GRCm39) V92E probably damaging Het
Scn7a A G 2: 66,567,815 (GRCm39) F260L probably damaging Het
Serpinb3a T A 1: 106,979,500 (GRCm39) M1L probably damaging Het
Sh3d19 T C 3: 86,031,020 (GRCm39) I728T probably benign Het
Sin3a T C 9: 57,002,642 (GRCm39) L178P probably damaging Het
Slc13a1 A G 6: 24,103,478 (GRCm39) V355A probably benign Het
St7 G A 6: 17,819,287 (GRCm39) V64M probably damaging Het
Tcf25 T A 8: 124,127,882 (GRCm39) L622* probably null Het
Tiam1 A G 16: 89,652,779 (GRCm39) V781A possibly damaging Het
Tigd2 C A 6: 59,187,562 (GRCm39) T143K probably benign Het
Tmem107 G T 11: 68,962,301 (GRCm39) probably null Het
Tmem161b G A 13: 84,399,359 (GRCm39) G5D probably damaging Het
Tonsl G A 15: 76,523,916 (GRCm39) A28V probably benign Het
Treml4 T C 17: 48,581,417 (GRCm39) Y222H probably damaging Het
Trp53bp1 A T 2: 121,087,131 (GRCm39) V175D probably damaging Het
Zfp184 T C 13: 22,144,072 (GRCm39) Y593H probably damaging Het
Zfp286 A G 11: 62,670,844 (GRCm39) C410R probably damaging Het
Zfp934 T G 13: 62,665,373 (GRCm39) N312H probably benign Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 42,931,920 (GRCm39) missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42,893,296 (GRCm39) missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42,901,351 (GRCm39) missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 42,934,137 (GRCm39) missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42,883,563 (GRCm39) missense probably benign
IGL02135:Arhgef12 APN 9 42,883,461 (GRCm39) missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 42,912,748 (GRCm39) missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42,893,339 (GRCm39) missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42,903,859 (GRCm39) missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 42,916,919 (GRCm39) missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 42,917,200 (GRCm39) nonsense probably null
IGL02803:Arhgef12 APN 9 42,883,324 (GRCm39) missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 42,912,268 (GRCm39) missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 42,927,216 (GRCm39) missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42,910,373 (GRCm39) missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 42,937,524 (GRCm39) missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42,885,866 (GRCm39) missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42,903,829 (GRCm39) splice site probably benign
IGL03398:Arhgef12 APN 9 42,889,522 (GRCm39) missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42,889,529 (GRCm39) missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 42,916,890 (GRCm39) missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42,883,300 (GRCm39) missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 42,931,982 (GRCm39) missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 42,929,697 (GRCm39) missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42,882,286 (GRCm39) splice site probably null
R0658:Arhgef12 UTSW 9 42,893,281 (GRCm39) missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42,904,324 (GRCm39) missense probably benign 0.02
R0693:Arhgef12 UTSW 9 42,929,697 (GRCm39) missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42,883,677 (GRCm39) missense probably benign 0.00
R1147:Arhgef12 UTSW 9 42,955,552 (GRCm39) unclassified probably benign
R1395:Arhgef12 UTSW 9 42,917,166 (GRCm39) missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 42,938,516 (GRCm39) missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42,903,874 (GRCm39) splice site probably benign
R1458:Arhgef12 UTSW 9 42,900,294 (GRCm39) missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42,908,956 (GRCm39) missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 42,932,013 (GRCm39) makesense probably null
R1773:Arhgef12 UTSW 9 42,916,838 (GRCm39) critical splice donor site probably null
R1895:Arhgef12 UTSW 9 42,917,152 (GRCm39) missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42,890,768 (GRCm39) missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 42,917,167 (GRCm39) missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 42,912,302 (GRCm39) missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42,886,588 (GRCm39) missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42,886,588 (GRCm39) missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42,883,570 (GRCm39) missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 42,929,645 (GRCm39) nonsense probably null
R4462:Arhgef12 UTSW 9 42,893,278 (GRCm39) missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42,888,958 (GRCm39) missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 42,921,489 (GRCm39) missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42,893,266 (GRCm39) missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42,883,449 (GRCm39) missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 42,931,992 (GRCm39) missense probably benign
R4840:Arhgef12 UTSW 9 42,886,364 (GRCm39) missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42,904,361 (GRCm39) nonsense probably null
R5176:Arhgef12 UTSW 9 42,931,982 (GRCm39) missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42,897,880 (GRCm39) missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 42,921,489 (GRCm39) missense probably benign 0.27
R5838:Arhgef12 UTSW 9 42,916,904 (GRCm39) missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42,900,261 (GRCm39) missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42,883,503 (GRCm39) missense probably benign 0.05
R6959:Arhgef12 UTSW 9 42,927,249 (GRCm39) missense probably benign
R7252:Arhgef12 UTSW 9 42,927,205 (GRCm39) missense probably benign 0.17
R7470:Arhgef12 UTSW 9 42,951,848 (GRCm39) missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42,903,832 (GRCm39) missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 42,938,567 (GRCm39) missense probably damaging 1.00
R7980:Arhgef12 UTSW 9 42,882,595 (GRCm39) nonsense probably null
R8074:Arhgef12 UTSW 9 42,882,399 (GRCm39) nonsense probably null
R8155:Arhgef12 UTSW 9 42,953,958 (GRCm39) missense probably damaging 1.00
R8270:Arhgef12 UTSW 9 42,882,354 (GRCm39) missense probably benign
R8407:Arhgef12 UTSW 9 42,937,475 (GRCm39) critical splice donor site probably null
R8527:Arhgef12 UTSW 9 42,908,944 (GRCm39) missense possibly damaging 0.95
R9116:Arhgef12 UTSW 9 42,893,241 (GRCm39) splice site probably benign
R9127:Arhgef12 UTSW 9 42,885,870 (GRCm39) missense possibly damaging 0.94
R9602:Arhgef12 UTSW 9 42,895,676 (GRCm39) missense probably damaging 1.00
R9665:Arhgef12 UTSW 9 42,929,650 (GRCm39) missense possibly damaging 0.89
R9733:Arhgef12 UTSW 9 42,901,294 (GRCm39) nonsense probably null
R9735:Arhgef12 UTSW 9 42,882,399 (GRCm39) nonsense probably null
R9760:Arhgef12 UTSW 9 42,903,318 (GRCm39) missense probably damaging 1.00
RF020:Arhgef12 UTSW 9 42,901,285 (GRCm39) missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42,882,368 (GRCm39) missense probably benign 0.00
Z1186:Arhgef12 UTSW 9 42,911,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGCAGACCAGCGACTG -3'
(R):5'- ATAAAGGTGTTCTCTGGCAGC -3'

Sequencing Primer
(F):5'- CGACTGAAAGATCATGGTGCTCC -3'
(R):5'- TGTTCTCTGGCAGCGCAGG -3'
Posted On 2016-04-01