Incidental Mutation 'R4356:Scfd1'
ID377754
Institutional Source Beutler Lab
Gene Symbol Scfd1
Ensembl Gene ENSMUSG00000020952
Gene NameSec1 family domain containing 1
Synonyms3110021P21Rik, RA410, STXBP1L2
MMRRC Submission 041669-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4356 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51377510-51450101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51439285 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 541 (N541K)
Ref Sequence ENSEMBL: ENSMUSP00000021335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335]
Predicted Effect probably benign
Transcript: ENSMUST00000021335
AA Change: N541K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952
AA Change: N541K

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000218138
AA Change: N122K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219686
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,820 T723A probably damaging Het
Alox5 C T 6: 116,420,258 V322I probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ankhd1 A T 18: 36,643,043 K1482* probably null Het
C130079G13Rik T A 3: 59,936,280 Y132N probably damaging Het
Cacna1e A C 1: 154,443,981 D1324E probably damaging Het
Ccdc150 A G 1: 54,353,054 D657G probably damaging Het
Celsr1 A G 15: 85,978,827 S1335P probably damaging Het
Cspg5 A G 9: 110,256,177 D391G probably damaging Het
Defa30 A T 8: 21,134,805 D48V possibly damaging Het
E2f7 T C 10: 110,759,851 Y136H probably damaging Het
Fbxw25 A T 9: 109,662,085 C122S probably damaging Het
Fgg A T 3: 83,012,943 D343V probably damaging Het
Flnb T A 14: 7,922,700 M1712K probably benign Het
Fnbp4 T C 2: 90,758,339 S485P probably damaging Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
Gast C A 11: 100,336,547 S22Y probably damaging Het
Gm20834 T A Y: 10,322,962 H158L possibly damaging Het
Gm4788 T A 1: 139,732,310 K621N probably damaging Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Impg2 C T 16: 56,260,164 T777I probably damaging Het
Kif11 C A 19: 37,411,435 T790K probably benign Het
Kif24 A G 4: 41,413,827 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Nectin1 A G 9: 43,792,505 D264G probably benign Het
Nipsnap3a T C 4: 52,995,979 probably null Het
Oit1 A G 14: 8,349,314 L212P probably damaging Het
Olfr1137 G A 2: 87,711,885 S7F possibly damaging Het
Olfr119 G T 17: 37,700,899 E76D probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcdhga4 C T 18: 37,687,611 H738Y probably damaging Het
Prickle2 A T 6: 92,411,509 I304K probably damaging Het
Ptprq A T 10: 107,608,364 Y1460N probably damaging Het
Rbl2 A G 8: 91,107,107 D812G probably damaging Het
Rbm19 A G 5: 120,140,362 T737A possibly damaging Het
Rbsn G A 6: 92,207,048 L95F possibly damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scube3 G A 17: 28,164,309 G442S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcc1 A G 9: 110,196,256 D667G probably damaging Het
Sned1 A T 1: 93,265,391 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sun3 A G 11: 9,016,328 V231A probably damaging Het
Vmn2r106 A T 17: 20,279,648 D108E probably benign Het
Xdh A G 17: 73,915,690 V560A probably benign Het
Zfp352 T A 4: 90,223,834 H70Q possibly damaging Het
Zfp40 C A 17: 23,177,190 C73F probably benign Het
Zfp975 A C 7: 42,661,827 L454R probably damaging Het
Zik1 A T 7: 10,490,341 C276* probably null Het
Other mutations in Scfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Scfd1 APN 12 51427869 missense probably benign 0.01
IGL00640:Scfd1 APN 12 51389315 missense probably benign 0.12
IGL01481:Scfd1 APN 12 51384120 missense probably damaging 0.99
IGL01585:Scfd1 APN 12 51415553 missense probably damaging 1.00
IGL01862:Scfd1 APN 12 51445711 missense probably damaging 1.00
IGL02000:Scfd1 APN 12 51414117 missense probably benign 0.03
IGL02226:Scfd1 APN 12 51389381 splice site probably benign
IGL02327:Scfd1 APN 12 51389317 missense possibly damaging 0.81
IGL02503:Scfd1 APN 12 51422921 missense possibly damaging 0.90
IGL02585:Scfd1 APN 12 51387107 missense probably damaging 0.97
IGL02732:Scfd1 APN 12 51422973 missense probably benign 0.01
R0671:Scfd1 UTSW 12 51412628 missense probably benign 0.01
R0707:Scfd1 UTSW 12 51412577 missense probably damaging 0.98
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1962:Scfd1 UTSW 12 51422986 missense probably benign 0.00
R2173:Scfd1 UTSW 12 51387079 missense probably benign 0.22
R2249:Scfd1 UTSW 12 51415516 missense possibly damaging 0.48
R3872:Scfd1 UTSW 12 51392196 missense probably damaging 0.98
R4080:Scfd1 UTSW 12 51431519 missense probably benign
R4841:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4842:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4909:Scfd1 UTSW 12 51390412 missense probably benign 0.00
R5004:Scfd1 UTSW 12 51444994 missense probably benign 0.03
R5275:Scfd1 UTSW 12 51415589 missense probably benign 0.19
R5494:Scfd1 UTSW 12 51396739 splice site probably null
R5779:Scfd1 UTSW 12 51431529 missense probably benign
R6000:Scfd1 UTSW 12 51445674 missense possibly damaging 0.55
R6017:Scfd1 UTSW 12 51445678 missense probably damaging 1.00
R6522:Scfd1 UTSW 12 51431541 missense probably benign 0.04
R6954:Scfd1 UTSW 12 51427946 critical splice donor site probably null
R7748:Scfd1 UTSW 12 51389357 missense probably benign 0.21
R7993:Scfd1 UTSW 12 51445707 missense probably damaging 1.00
R8122:Scfd1 UTSW 12 51433269 missense possibly damaging 0.95
R8353:Scfd1 UTSW 12 51412591 missense possibly damaging 0.91
R8453:Scfd1 UTSW 12 51412591 missense possibly damaging 0.91
RF007:Scfd1 UTSW 12 51422973 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGCCCTGGAAATGCTTTG -3'
(R):5'- TGCCACTGAGAACATGGACTC -3'

Sequencing Primer
(F):5'- CCCTGGAAATGCTTTGAATTTTGC -3'
(R):5'- CACTGAGAACATGGACTCTTTGC -3'
Posted On2016-04-01