Incidental Mutation 'R4319:Ccdc178'
ID377764
Institutional Source Beutler Lab
Gene Symbol Ccdc178
Ensembl Gene ENSMUSG00000024306
Gene Namecoiled coil domain containing 178
Synonyms4921528I01Rik
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4319 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location21810897-22171396 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22033543 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 530 (K530*)
Ref Sequence ENSEMBL: ENSMUSP00000111503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025160] [ENSMUST00000115837]
Predicted Effect probably null
Transcript: ENSMUST00000025160
AA Change: K530*
SMART Domains Protein: ENSMUSP00000025160
Gene: ENSMUSG00000024306
AA Change: K530*

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115837
AA Change: K530*
SMART Domains Protein: ENSMUSP00000111503
Gene: ENSMUSG00000024306
AA Change: K530*

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Ccdc178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Ccdc178 APN 18 21844911 missense probably benign 0.05
IGL00743:Ccdc178 APN 18 22145444 splice site probably benign
IGL00906:Ccdc178 APN 18 22135168 nonsense probably null
IGL01352:Ccdc178 APN 18 22018974 splice site probably benign
IGL01553:Ccdc178 APN 18 21915006 missense probably damaging 0.97
IGL01607:Ccdc178 APN 18 22067721 missense probably benign 0.01
IGL01733:Ccdc178 APN 18 22024812 splice site probably benign
IGL01795:Ccdc178 APN 18 22019118 missense probably benign 0.04
IGL01996:Ccdc178 APN 18 22097756 missense probably damaging 0.99
IGL02939:Ccdc178 APN 18 22120718 missense probably benign 0.01
IGL03213:Ccdc178 APN 18 22120691 missense possibly damaging 0.89
IGL03253:Ccdc178 APN 18 21845011 nonsense probably null
IGL03331:Ccdc178 APN 18 21811583 splice site probably null
PIT4520001:Ccdc178 UTSW 18 22067413 missense probably damaging 0.97
R0121:Ccdc178 UTSW 18 21845024 critical splice acceptor site probably null
R0153:Ccdc178 UTSW 18 22150435 missense probably benign 0.00
R0364:Ccdc178 UTSW 18 21915062 missense probably damaging 0.97
R0604:Ccdc178 UTSW 18 22067443 missense probably benign 0.01
R0709:Ccdc178 UTSW 18 22067662 missense probably damaging 0.97
R0961:Ccdc178 UTSW 18 22019041 missense possibly damaging 0.79
R1029:Ccdc178 UTSW 18 22097725 missense possibly damaging 0.89
R1456:Ccdc178 UTSW 18 22150424 missense possibly damaging 0.81
R1481:Ccdc178 UTSW 18 22105621 missense probably benign 0.00
R1596:Ccdc178 UTSW 18 22020873 missense possibly damaging 0.79
R1739:Ccdc178 UTSW 18 22097723 missense possibly damaging 0.92
R1838:Ccdc178 UTSW 18 22067638 missense probably damaging 0.97
R2214:Ccdc178 UTSW 18 21914990 missense possibly damaging 0.73
R2401:Ccdc178 UTSW 18 22131414 critical splice donor site probably null
R2679:Ccdc178 UTSW 18 21811556 missense possibly damaging 0.90
R3051:Ccdc178 UTSW 18 22135131 missense probably benign 0.05
R3150:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3151:Ccdc178 UTSW 18 21811561 missense probably benign 0.00
R3177:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3277:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3903:Ccdc178 UTSW 18 22023095 missense possibly damaging 0.79
R4184:Ccdc178 UTSW 18 22024784 missense probably damaging 1.00
R4258:Ccdc178 UTSW 18 22017335 splice site probably null
R4321:Ccdc178 UTSW 18 22033543 nonsense probably null
R4323:Ccdc178 UTSW 18 22033543 nonsense probably null
R4509:Ccdc178 UTSW 18 22067392 missense possibly damaging 0.94
R4672:Ccdc178 UTSW 18 22150444 nonsense probably null
R5078:Ccdc178 UTSW 18 22067628 critical splice donor site probably null
R5099:Ccdc178 UTSW 18 22105591 missense probably benign
R5679:Ccdc178 UTSW 18 22067429 missense probably benign
R5683:Ccdc178 UTSW 18 22130122 missense probably benign 0.00
R6120:Ccdc178 UTSW 18 22097728 missense probably benign 0.00
R6318:Ccdc178 UTSW 18 22120534 missense possibly damaging 0.90
R6717:Ccdc178 UTSW 18 22020889 missense probably damaging 0.98
R6853:Ccdc178 UTSW 18 22109876 missense probably benign 0.00
R6980:Ccdc178 UTSW 18 22105563 missense probably benign
R7019:Ccdc178 UTSW 18 22150438 missense probably benign 0.00
R7246:Ccdc178 UTSW 18 22109754 missense possibly damaging 0.92
R7322:Ccdc178 UTSW 18 22105549 missense probably benign 0.15
R7340:Ccdc178 UTSW 18 22017461 missense probably benign 0.17
R7371:Ccdc178 UTSW 18 22130138 missense probably benign 0.01
R8003:Ccdc178 UTSW 18 21844887 critical splice donor site probably null
X0063:Ccdc178 UTSW 18 21844912 missense probably benign 0.12
Z1177:Ccdc178 UTSW 18 22109731 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATCCATGTGGTGCACCTTCC -3'
(R):5'- CACTCTCTATGAATAGCTGGACTAATC -3'

Sequencing Primer
(F):5'- AAGCCAGTTCATCGACTTGG -3'
(R):5'- GAATAGCTGGACTAATCTTTGCTTC -3'
Posted On2016-04-01