Incidental Mutation 'R4414:Fbxl6'
ID 377776
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R4414 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76535721-76538746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76537724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect possibly damaging
Transcript: ENSMUST00000023219
AA Change: E205G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: E205G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230513
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230994
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76537083 splice site probably null
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4416:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76537929 missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
R7811:Fbxl6 UTSW 15 76537285 splice site probably null
R8353:Fbxl6 UTSW 15 76538478 missense probably benign 0.06
R8548:Fbxl6 UTSW 15 76537342 missense possibly damaging 0.65
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGACAAGCCTATCCTATAGTCCC -3'
(R):5'- AGGGCTCCTTGTCATCTTACTG -3'

Sequencing Primer
(F):5'- AAGCCTATCCTATAGTCCCAGCTATG -3'
(R):5'- GCTCCTTGTCATCTTACTGTCTGTTG -3'
Posted On 2016-04-05