Incidental Mutation 'R4664:Cyth2'
ID377793
Institutional Source Beutler Lab
Gene Symbol Cyth2
Ensembl Gene ENSMUSG00000003269
Gene Namecytohesin 2
SynonymsARNO, CLM2, Pscd2
MMRRC Submission 041922-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R4664 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45806637-45814581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45810719 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 183 (D183G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056820] [ENSMUST00000107729] [ENSMUST00000209245] [ENSMUST00000210137] [ENSMUST00000210853] [ENSMUST00000210898] [ENSMUST00000211263] [ENSMUST00000211783]
Predicted Effect probably damaging
Transcript: ENSMUST00000056820
AA Change: D183G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051423
Gene: ENSMUSG00000003269
AA Change: D183G

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
PH 260 378 3.07e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107726
AA Change: D167G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103354
Gene: ENSMUSG00000003269
AA Change: D167G

DomainStartEndE-ValueType
Sec7 42 227 1.03e-102 SMART
PH 244 361 1.16e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107728
AA Change: D183G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103356
Gene: ENSMUSG00000003269
AA Change: D183G

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
PH 260 388 3.07e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107729
AA Change: D183G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103357
Gene: ENSMUSG00000003269
AA Change: D183G

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
PH 260 377 1.16e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139376
AA Change: D183G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119068
Gene: ENSMUSG00000003269
AA Change: D183G

DomainStartEndE-ValueType
Sec7 58 243 1.03e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209245
AA Change: D183G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000210137
Predicted Effect probably damaging
Transcript: ENSMUST00000210853
AA Change: D183G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210898
Predicted Effect probably benign
Transcript: ENSMUST00000211263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211394
Predicted Effect probably damaging
Transcript: ENSMUST00000211783
AA Change: D167G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000223361
AA Change: D12G
Meta Mutation Damage Score 0.9161 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. The encoded protein exhibits GEP activity in vitro with ARF1, ARF3, and ARF6 and is 83% homologous to CYTH1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cell exhibit reduced sciatic nerve myelin sheath thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,863,538 I391V probably benign Het
Apc T A 18: 34,298,594 L349M probably damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Atp8a1 T A 5: 67,762,586 D379V possibly damaging Het
Aurkb A G 11: 69,048,609 K173E probably damaging Het
Bak1 T C 17: 27,022,536 I83V possibly damaging Het
Btbd17 A C 11: 114,794,006 V69G probably damaging Het
Cacna1a T A 8: 84,601,767 Y1597* probably null Het
Camk2a C A 18: 60,955,624 Q167K possibly damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Ccer2 A G 7: 28,756,503 E40G probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Cdkl2 T C 5: 92,037,265 D89G probably damaging Het
Cep128 G T 12: 91,296,253 R291S probably damaging Het
Chd4 A G 6: 125,101,502 M203V possibly damaging Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cic TGTTGCCCTC T 7: 25,290,674 probably benign Het
Cntn5 T A 9: 10,144,209 I152L possibly damaging Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col16a1 A C 4: 130,062,090 probably benign Het
Col4a3bp T C 13: 96,599,457 V175A probably benign Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Ddx47 A T 6: 135,012,356 T48S possibly damaging Het
Dgkk A G X: 6,928,512 D685G probably benign Het
Dis3l C T 9: 64,330,798 S29N unknown Het
Dlg5 T C 14: 24,137,181 H1834R possibly damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dock3 T A 9: 106,993,544 N557I possibly damaging Het
Eprs A T 1: 185,373,076 probably benign Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam84b A T 15: 60,823,629 D89E probably benign Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fance T C 17: 28,315,662 probably benign Het
Farsb A T 1: 78,443,765 H496Q possibly damaging Het
Fryl C T 5: 73,090,679 E1032K possibly damaging Het
Galnt14 A T 17: 73,507,813 probably benign Het
Gba2 A T 4: 43,568,619 probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gmcl1 G A 6: 86,732,998 T56I probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtpbp2 T C 17: 46,161,154 V5A probably benign Het
Hnrnpr A G 4: 136,317,175 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Hsd3b3 T C 3: 98,742,216 S264G probably damaging Het
Ints8 T C 4: 11,227,152 M574V probably benign Het
Kif4-ps G A 12: 101,149,218 noncoding transcript Het
Klhl14 A T 18: 21,554,708 N552K probably benign Het
Klhl40 A G 9: 121,780,733 E528G probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mab21l2 T A 3: 86,547,504 Y63F probably benign Het
Mbd1 T A 18: 74,269,526 I33N possibly damaging Het
Mertk G A 2: 128,801,212 V844M probably benign Het
Mgea5 T C 19: 45,771,945 E258G probably benign Het
Myh11 T C 16: 14,226,584 T652A possibly damaging Het
Nlrp4a C A 7: 26,449,518 Y183* probably null Het
Noa1 T A 5: 77,299,753 T558S probably benign Het
Nol11 A T 11: 107,181,000 S256T possibly damaging Het
Nr1d1 G T 11: 98,771,260 R183S possibly damaging Het
Nrg2 G T 18: 36,052,895 Q264K possibly damaging Het
Nsd3 T A 8: 25,698,866 F1027I probably damaging Het
Ntrk3 T A 7: 78,461,099 I285F probably damaging Het
Obox8 T C 7: 14,332,846 N91S possibly damaging Het
Orc5 C T 5: 22,546,522 S63N probably benign Het
Osbpl6 C T 2: 76,568,208 T412I probably benign Het
P2ry14 C T 3: 59,115,142 C308Y probably damaging Het
Pacsin1 T C 17: 27,707,064 F127L probably damaging Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Pla2g4e A T 2: 120,171,188 V660E probably damaging Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Polr3b A G 10: 84,714,369 Y981C probably damaging Het
Popdc2 T A 16: 38,374,287 S357T probably damaging Het
Prr29 A G 11: 106,376,333 H58R probably damaging Het
Pyy T A 11: 102,107,352 M1L possibly damaging Het
Rasd2 T C 8: 75,221,928 S161P possibly damaging Het
Ryr3 C T 2: 112,996,555 probably benign Het
Sectm1a G A 11: 121,069,726 R88C possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Siglecf A T 7: 43,356,413 I465F possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Spam1 A T 6: 24,796,662 H204L probably benign Het
Sspo A T 6: 48,473,534 N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,462,827 probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Tedc2 A G 17: 24,220,140 probably benign Het
Tgm6 A G 2: 130,137,394 D148G probably benign Het
Tgm6 A T 2: 130,141,208 Q239L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmem54 A T 4: 129,110,911 E186D possibly damaging Het
Tpk1 A T 6: 43,611,335 F32I probably benign Het
Trpc4ap A G 2: 155,672,997 I97T probably benign Het
Txlnb A G 10: 17,843,194 E591G probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ubr4 G A 4: 139,406,518 E742K possibly damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uevld T A 7: 46,937,986 D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r238 G T 18: 3,123,300 T38K probably damaging Het
Vps8 T A 16: 21,444,188 probably null Het
Wdr60 T C 12: 116,256,211 E37G probably damaging Het
Wdr83 T C 8: 85,080,051 probably benign Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp619 A G 7: 39,534,135 T51A probably benign Het
Other mutations in Cyth2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Cyth2 APN 7 45808389 missense probably damaging 1.00
IGL01957:Cyth2 APN 7 45808381 missense probably benign 0.00
FR4737:Cyth2 UTSW 7 45813042 missense possibly damaging 0.90
R0302:Cyth2 UTSW 7 45810585 nonsense probably null
R0600:Cyth2 UTSW 7 45813117 missense probably damaging 1.00
R5102:Cyth2 UTSW 7 45810702 missense probably damaging 1.00
R7532:Cyth2 UTSW 7 45808024 missense probably benign 0.20
R7846:Cyth2 UTSW 7 45810954 missense probably damaging 1.00
R7929:Cyth2 UTSW 7 45810954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGAGCACAAGGTTAGAAG -3'
(R):5'- ATTGATCGAATGATGGAGGCC -3'

Sequencing Primer
(F):5'- TTAGAAGAGGGTGGGGCTG -3'
(R):5'- TGCCCAGAGATACTGCTTATG -3'
Posted On2016-04-06