Incidental Mutation 'R4364:Dpp9'
ID377800
Institutional Source Beutler Lab
Gene Symbol Dpp9
Ensembl Gene ENSMUSG00000001229
Gene Namedipeptidylpeptidase 9
SynonymsDPRP2, 6430584G11Rik
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4364 (G1)
Quality Score57
Status Validated
Chromosome17
Chromosomal Location56186807-56218889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56187391 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 856 (H856R)
Ref Sequence ENSEMBL: ENSMUSP00000046604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019723] [ENSMUST00000038794]
Predicted Effect probably benign
Transcript: ENSMUST00000019723
SMART Domains Protein: ENSMUSP00000019723
Gene: ENSMUSG00000019579

DomainStartEndE-ValueType
Pfam:UPF0556 11 166 4.8e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000038794
AA Change: H856R

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229
AA Change: H856R

DomainStartEndE-ValueType
low complexity region 122 133 N/A INTRINSIC
Pfam:DPPIV_N 145 569 5.2e-109 PFAM
Pfam:Peptidase_S15 617 793 2.8e-10 PFAM
Pfam:Peptidase_S9 657 862 2.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223616
Meta Mutation Damage Score 0.1293 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Dpp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Dpp9 APN 17 56205240 missense probably damaging 0.99
IGL00920:Dpp9 APN 17 56200599 missense probably benign 0.01
IGL01568:Dpp9 APN 17 56191159 missense probably benign
IGL01583:Dpp9 APN 17 56211666 missense probably benign 0.00
IGL01613:Dpp9 APN 17 56190713 missense probably benign
IGL03371:Dpp9 APN 17 56187377 missense probably benign 0.00
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0418:Dpp9 UTSW 17 56194404 splice site probably benign
R1163:Dpp9 UTSW 17 56199426 missense possibly damaging 0.90
R1680:Dpp9 UTSW 17 56190103 missense probably benign 0.00
R1709:Dpp9 UTSW 17 56194431 missense probably benign
R1762:Dpp9 UTSW 17 56188362 missense probably damaging 1.00
R1809:Dpp9 UTSW 17 56199038 missense probably damaging 1.00
R1853:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R1854:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R2162:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R2205:Dpp9 UTSW 17 56199287 missense possibly damaging 0.87
R2301:Dpp9 UTSW 17 56194973 missense probably benign 0.00
R2520:Dpp9 UTSW 17 56206868 missense probably damaging 1.00
R3831:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R3833:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R4737:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4740:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4741:Dpp9 UTSW 17 56205286 missense probably benign
R4798:Dpp9 UTSW 17 56191016 missense probably damaging 0.96
R4806:Dpp9 UTSW 17 56190030 missense probably damaging 1.00
R5375:Dpp9 UTSW 17 56189424 nonsense probably null
R5709:Dpp9 UTSW 17 56189393 missense probably benign
R5783:Dpp9 UTSW 17 56211655 missense probably damaging 0.98
R6454:Dpp9 UTSW 17 56206808 missense probably damaging 1.00
R6532:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R6894:Dpp9 UTSW 17 56188321 missense probably damaging 1.00
R7398:Dpp9 UTSW 17 56189405 nonsense probably null
R7494:Dpp9 UTSW 17 56200619 missense probably damaging 1.00
R7495:Dpp9 UTSW 17 56195044 missense probably benign
R7511:Dpp9 UTSW 17 56205611 missense possibly damaging 0.52
R7556:Dpp9 UTSW 17 56190012 missense possibly damaging 0.66
X0065:Dpp9 UTSW 17 56195006 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTGTGCTCAATGGCGACTTC -3'
(R):5'- ACATAGACCTGGTGCCACAG -3'

Sequencing Primer
(F):5'- AATGGCGACTTCTCCTCACCAG -3'
(R):5'- TAGACCTGGTGCCACAGTAACTATG -3'
Posted On2016-04-06