Incidental Mutation 'R4552:Odf2l'
ID377803
Institutional Source Beutler Lab
Gene Symbol Odf2l
Ensembl Gene ENSMUSG00000028256
Gene Nameouter dense fiber of sperm tails 2-like
Synonyms9630045K08Rik, 4733401D09Rik
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145118588-145153915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145151083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 600 (T600S)
Ref Sequence ENSEMBL: ENSMUSP00000096140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029920] [ENSMUST00000098538] [ENSMUST00000098539] [ENSMUST00000106192] [ENSMUST00000200353]
Predicted Effect probably benign
Transcript: ENSMUST00000029920
AA Change: T504S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029920
Gene: ENSMUSG00000028256
AA Change: T504S

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
coiled coil region 85 183 N/A INTRINSIC
coiled coil region 206 367 N/A INTRINSIC
coiled coil region 388 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098538
AA Change: T600S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096140
Gene: ENSMUSG00000028256
AA Change: T600S

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098539
AA Change: T547S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096141
Gene: ENSMUSG00000028256
AA Change: T547S

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106192
AA Change: T547S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101798
Gene: ENSMUSG00000028256
AA Change: T547S

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200014
Predicted Effect probably benign
Transcript: ENSMUST00000200353
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Odf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Odf2l APN 3 145127873 missense possibly damaging 0.93
IGL00821:Odf2l APN 3 145150987 missense probably damaging 1.00
IGL01984:Odf2l APN 3 145139829 nonsense probably null
R0080:Odf2l UTSW 3 145124323 missense possibly damaging 0.63
R0133:Odf2l UTSW 3 145148541 missense probably damaging 0.96
R0436:Odf2l UTSW 3 145126116 missense possibly damaging 0.91
R1218:Odf2l UTSW 3 145148932 missense probably damaging 1.00
R1521:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R1677:Odf2l UTSW 3 145139782 critical splice acceptor site probably null
R1884:Odf2l UTSW 3 145151048 missense probably damaging 1.00
R2151:Odf2l UTSW 3 145149024 missense possibly damaging 0.86
R2910:Odf2l UTSW 3 145124323 missense probably benign 0.00
R2911:Odf2l UTSW 3 145124323 missense probably benign 0.00
R4640:Odf2l UTSW 3 145128945 missense probably damaging 1.00
R4667:Odf2l UTSW 3 145128040 missense probably benign 0.04
R5472:Odf2l UTSW 3 145146866 missense probably benign 0.00
R5769:Odf2l UTSW 3 145135731 missense possibly damaging 0.91
R5877:Odf2l UTSW 3 145129010 unclassified probably null
R6026:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6351:Odf2l UTSW 3 145135718 missense probably benign 0.11
R6454:Odf2l UTSW 3 145153420 missense possibly damaging 0.93
R6462:Odf2l UTSW 3 145146911 missense probably damaging 1.00
R6888:Odf2l UTSW 3 145148618 critical splice donor site probably null
R7008:Odf2l UTSW 3 145132734 missense probably damaging 1.00
R7121:Odf2l UTSW 3 145139820 missense possibly damaging 0.93
R7151:Odf2l UTSW 3 145127066 missense probably benign 0.26
R7542:Odf2l UTSW 3 145153436 missense probably damaging 0.99
R7664:Odf2l UTSW 3 145148584 missense probably benign 0.41
R7811:Odf2l UTSW 3 145153387 missense probably benign 0.00
R7816:Odf2l UTSW 3 145151015 missense probably damaging 1.00
R7913:Odf2l UTSW 3 145153483 nonsense probably null
R7994:Odf2l UTSW 3 145153483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATACCCAACTAATATCTACTTGGG -3'
(R):5'- TGACTGAAGCTGCACAGAG -3'

Sequencing Primer
(F):5'- ACTGTGACTATATCAGGGCTTC -3'
(R):5'- CACAGAGCAGGGTGATGAAAACTC -3'
Posted On2016-04-06