Incidental Mutation 'R0304:Gm4787'
ID 37781
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
MMRRC Submission 038515-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R0304 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 81423765-81426238 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81425708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 150 (I150N)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably damaging
Transcript: ENSMUST00000062182
AA Change: I150N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: I150N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 C T 4: 144,246,619 (GRCm39) T55I probably benign Het
Acod1 T A 14: 103,292,418 (GRCm39) I314N probably damaging Het
Actl11 T A 9: 107,806,967 (GRCm39) V430E probably damaging Het
Adam19 A C 11: 46,018,219 (GRCm39) D427A possibly damaging Het
Adarb2 C T 13: 8,802,606 (GRCm39) probably benign Het
Akap7 A T 10: 25,147,450 (GRCm39) H93Q probably damaging Het
Ankrd36 C A 11: 5,578,981 (GRCm39) R82S possibly damaging Het
Arhgap21 A T 2: 20,864,612 (GRCm39) probably benign Het
Atm T A 9: 53,427,644 (GRCm39) I489F probably benign Het
Carmil1 T C 13: 24,323,324 (GRCm39) S243G probably damaging Het
Cdc42bpg T C 19: 6,367,278 (GRCm39) V939A probably damaging Het
Cel A C 2: 28,447,783 (GRCm39) L377R probably benign Het
Clock A G 5: 76,374,832 (GRCm39) V779A unknown Het
Cluap1 G A 16: 3,747,782 (GRCm39) probably benign Het
Ctif A T 18: 75,654,889 (GRCm39) H212Q probably benign Het
Cyp4a29 T A 4: 115,110,129 (GRCm39) probably benign Het
Cytip T C 2: 58,038,258 (GRCm39) N101S possibly damaging Het
D130043K22Rik T C 13: 25,048,798 (GRCm39) M434T probably benign Het
Ddx47 A G 6: 134,994,183 (GRCm39) I154V possibly damaging Het
Dnah6 C T 6: 73,136,098 (GRCm39) E1014K probably damaging Het
Dnajc27 T G 12: 4,156,793 (GRCm39) probably benign Het
Drc7 A T 8: 95,785,756 (GRCm39) D204V probably damaging Het
Dsc3 A G 18: 20,114,298 (GRCm39) Y319H probably damaging Het
Eml6 T C 11: 29,727,441 (GRCm39) Q1227R probably benign Het
Enpp2 A T 15: 54,741,202 (GRCm39) D365E probably benign Het
Ercc2 T C 7: 19,120,633 (GRCm39) I199T possibly damaging Het
Exd2 G A 12: 80,538,014 (GRCm39) probably benign Het
F2 A T 2: 91,463,578 (GRCm39) I128N probably damaging Het
Fam219b T C 9: 57,446,159 (GRCm39) L123P probably damaging Het
Fasn A G 11: 120,710,762 (GRCm39) V299A possibly damaging Het
Fastkd2 T C 1: 63,791,559 (GRCm39) V689A possibly damaging Het
Fbxw13 C T 9: 109,023,789 (GRCm39) R85Q probably benign Het
Fer1l6 A G 15: 58,462,411 (GRCm39) Y822C probably benign Het
Fhl5 T C 4: 25,207,241 (GRCm39) T176A probably benign Het
Gm20530 T G 17: 36,405,118 (GRCm39) noncoding transcript Het
Grip1 G A 10: 119,911,376 (GRCm39) S618N probably benign Het
Hdac9 T C 12: 34,424,110 (GRCm39) K454E probably damaging Het
Iars2 T A 1: 185,019,353 (GRCm39) I978F possibly damaging Het
Icosl A G 10: 77,911,156 (GRCm39) Y299C probably benign Het
Idi1 T C 13: 8,940,393 (GRCm39) Y192H probably damaging Het
Iqub T G 6: 24,454,290 (GRCm39) Q531P probably damaging Het
Itih4 T A 14: 30,612,051 (GRCm39) probably null Het
Izumo4 A T 10: 80,538,770 (GRCm39) H71L probably damaging Het
Jcad A T 18: 4,673,325 (GRCm39) E362D possibly damaging Het
Kif21a G T 15: 90,860,724 (GRCm39) probably null Het
Kynu A T 2: 43,569,893 (GRCm39) I392F probably damaging Het
Luc7l2 A G 6: 38,569,711 (GRCm39) E223G probably damaging Het
Map3k8 A C 18: 4,339,552 (GRCm39) L273R probably damaging Het
Max A G 12: 76,985,361 (GRCm39) L119P probably benign Het
Mphosph9 T C 5: 124,436,892 (GRCm39) N484S probably benign Het
Mrgprg A G 7: 143,318,792 (GRCm39) Y107H probably damaging Het
Mrps31 A T 8: 22,911,354 (GRCm39) I199F probably benign Het
Mtr C G 13: 12,237,040 (GRCm39) probably null Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Nkapd1 T C 9: 50,519,222 (GRCm39) D130G probably damaging Het
Nptx2 A G 5: 144,490,460 (GRCm39) probably benign Het
Nrip1 T C 16: 76,089,595 (GRCm39) Q654R possibly damaging Het
Ocm A G 5: 143,961,352 (GRCm39) F30L probably damaging Het
Oosp1 T C 19: 11,668,333 (GRCm39) M17V probably benign Het
Or14c45 C T 7: 86,176,195 (GRCm39) P77S probably damaging Het
Or4c111 G A 2: 88,843,632 (GRCm39) R259W probably damaging Het
Or4c118 A C 2: 88,975,108 (GRCm39) Y86* probably null Het
Or52ad1 G T 7: 102,995,918 (GRCm39) D72E probably damaging Het
Pax1 A T 2: 147,208,067 (GRCm39) Y225F probably benign Het
Pde4dip T A 3: 97,751,028 (GRCm39) H62L probably benign Het
Pkd1 C A 17: 24,804,920 (GRCm39) Q3190K probably damaging Het
Pkn1 A C 8: 84,410,236 (GRCm39) probably benign Het
Plin5 T C 17: 56,422,597 (GRCm39) D113G probably damaging Het
Ppfia1 A G 7: 144,036,082 (GRCm39) V1141A probably damaging Het
Ppp4r1 T A 17: 66,123,001 (GRCm39) D334E probably benign Het
Ptov1 A T 7: 44,512,873 (GRCm39) probably null Het
Rab22a G A 2: 173,503,252 (GRCm39) V22M probably damaging Het
Rictor T A 15: 6,815,852 (GRCm39) probably null Het
Sart1 G T 19: 5,430,559 (GRCm39) probably benign Het
Scn11a G A 9: 119,648,928 (GRCm39) A45V probably benign Het
Serpina5 A G 12: 104,069,459 (GRCm39) T224A possibly damaging Het
Siglecf G T 7: 43,001,825 (GRCm39) G212C probably damaging Het
Slc38a4 A T 15: 96,906,335 (GRCm39) M378K probably damaging Het
Spata22 T A 11: 73,231,275 (GRCm39) C176* probably null Het
Tmc3 G A 7: 83,245,347 (GRCm39) E131K probably damaging Het
Trappc10 A T 10: 78,046,594 (GRCm39) probably benign Het
Uvrag A G 7: 98,537,180 (GRCm39) F672L probably benign Het
Vmn1r121 A G 7: 20,832,332 (GRCm39) V36A possibly damaging Het
Vmn1r13 A T 6: 57,187,611 (GRCm39) M257L probably benign Het
Vmn1r58 C T 7: 5,413,495 (GRCm39) C245Y probably damaging Het
Vmn1r86 C A 7: 12,836,707 (GRCm39) M56I probably benign Het
Wdr62 T C 7: 29,942,299 (GRCm39) Y1051C probably benign Het
Xpnpep3 A G 15: 81,314,915 (GRCm39) D205G probably damaging Het
Zdhhc14 T C 17: 5,775,611 (GRCm39) probably benign Het
Zfp607a A T 7: 27,578,637 (GRCm39) D569V possibly damaging Het
Zfp609 C T 9: 65,608,470 (GRCm39) E1137K possibly damaging Het
Zfp871 T C 17: 32,993,408 (GRCm39) Y589C probably damaging Het
Zzef1 A T 11: 72,771,450 (GRCm39) D1644V probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81,423,948 (GRCm39) missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81,424,218 (GRCm39) missense probably benign 0.36
IGL02193:Gm4787 APN 12 81,425,302 (GRCm39) missense probably benign 0.02
IGL02623:Gm4787 APN 12 81,425,502 (GRCm39) missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81,425,543 (GRCm39) missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81,424,826 (GRCm39) missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81,425,948 (GRCm39) missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
PIT4362001:Gm4787 UTSW 12 81,423,949 (GRCm39) missense probably benign
R0070:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81,424,521 (GRCm39) nonsense probably null
R0220:Gm4787 UTSW 12 81,425,422 (GRCm39) missense probably damaging 0.98
R0513:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
R1761:Gm4787 UTSW 12 81,423,950 (GRCm39) missense probably benign 0.02
R1809:Gm4787 UTSW 12 81,425,303 (GRCm39) missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81,425,544 (GRCm39) missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81,425,694 (GRCm39) missense probably benign 0.39
R2112:Gm4787 UTSW 12 81,424,607 (GRCm39) missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81,425,336 (GRCm39) missense probably benign 0.03
R2151:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2152:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2342:Gm4787 UTSW 12 81,425,532 (GRCm39) missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81,425,911 (GRCm39) missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81,425,132 (GRCm39) missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81,425,987 (GRCm39) missense probably benign 0.17
R4748:Gm4787 UTSW 12 81,424,830 (GRCm39) missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81,425,141 (GRCm39) missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81,425,612 (GRCm39) missense probably benign 0.03
R4960:Gm4787 UTSW 12 81,426,090 (GRCm39) missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81,424,403 (GRCm39) missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5029:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5031:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5098:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5099:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5100:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5101:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5135:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5152:Gm4787 UTSW 12 81,425,451 (GRCm39) missense probably benign 0.02
R5180:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5220:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5257:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5258:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5297:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5324:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5325:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5355:Gm4787 UTSW 12 81,424,239 (GRCm39) nonsense probably null
R5364:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5396:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5397:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5398:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5514:Gm4787 UTSW 12 81,425,102 (GRCm39) missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5666:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5670:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5787:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5788:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R6354:Gm4787 UTSW 12 81,424,755 (GRCm39) missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81,425,974 (GRCm39) missense probably benign 0.04
R7120:Gm4787 UTSW 12 81,425,260 (GRCm39) missense probably benign 0.00
R7237:Gm4787 UTSW 12 81,424,442 (GRCm39) missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81,424,679 (GRCm39) missense probably benign 0.01
R8022:Gm4787 UTSW 12 81,424,494 (GRCm39) missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81,424,925 (GRCm39) missense probably benign 0.00
R8314:Gm4787 UTSW 12 81,425,909 (GRCm39) missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81,424,280 (GRCm39) missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81,424,043 (GRCm39) missense probably benign 0.00
R9103:Gm4787 UTSW 12 81,425,489 (GRCm39) missense probably benign 0.06
R9457:Gm4787 UTSW 12 81,426,020 (GRCm39) missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81,426,074 (GRCm39) nonsense probably null
R9608:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
V7580:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7581:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7582:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCAGCGAGCTTAGTCTCTTCAG -3'
(R):5'- TTCCCCAGAGAATGGGCAAAAGTG -3'

Sequencing Primer
(F):5'- AGTCTCTTCAGGGAGGTTACCTAC -3'
(R):5'- TGTGGTCCACATGAAACTCAAG -3'
Posted On 2013-05-23