Incidental Mutation 'R4493:Ppih'
List |< first << previous [record 29 of 41] next >> last >|
ID377824
Institutional Source Beutler Lab
Gene Symbol Ppih
Ensembl Gene ENSMUSG00000060288
Gene Namepeptidyl prolyl isomerase H
Synonymscyclophilin H, rotamase H, CYP-20, D4Wsu43e, 4833408F11Rik, 2010111B15Rik, 1100001J08Rik
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119300010-119320546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119310845 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 156 (N156K)
Ref Sequence ENSEMBL: ENSMUSP00000101928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056458] [ENSMUST00000106317] [ENSMUST00000106318] [ENSMUST00000106319] [ENSMUST00000106321] [ENSMUST00000147077]
Predicted Effect probably damaging
Transcript: ENSMUST00000056458
AA Change: N156K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051221
Gene: ENSMUSG00000060288
AA Change: N156K

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106317
SMART Domains Protein: ENSMUSP00000101924
Gene: ENSMUSG00000060288

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 170 2.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106318
AA Change: N156K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101925
Gene: ENSMUSG00000060288
AA Change: N156K

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106319
AA Change: N113K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101926
Gene: ENSMUSG00000060288
AA Change: N113K

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 132 8.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106321
AA Change: N156K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101928
Gene: ENSMUSG00000060288
AA Change: N156K

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 176 5.8e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147077
AA Change: N137K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118407
Gene: ENSMUSG00000060288
AA Change: N137K

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 157 2.9e-48 PFAM
Meta Mutation Damage Score 0.1861 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is a specific component of the complex that includes pre-mRNA processing factors PRPF3, PRPF4, and PRPF18, as well as U4/U5/U6 tri-snRNP. This protein has been shown to possess PPIase activity and may act as a protein chaperone that mediates the interactions between different proteins inside the spliceosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Ppih
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02006:Ppih APN 4 119311582 splice site probably benign
R0005:Ppih UTSW 4 119318601 splice site probably benign
R1625:Ppih UTSW 4 119318582 missense probably damaging 1.00
R4539:Ppih UTSW 4 119320459 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCAGAGGAAATGGACTCAGTC -3'
(R):5'- GCTGGATCCCTTCAGTGTTC -3'

Sequencing Primer
(F):5'- CTCAGTCCACATCTTTGGGTAGAAAG -3'
(R):5'- AACTTGCATGATCCCATTGTGG -3'
Posted On2016-04-11