Incidental Mutation 'R4516:Ncbp1'
ID377826
Institutional Source Beutler Lab
Gene Symbol Ncbp1
Ensembl Gene ENSMUSG00000028330
Gene Namenuclear cap binding protein subunit 1
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46138613-46172403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46157824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 354 (V354A)
Ref Sequence ENSEMBL: ENSMUSP00000030014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030014] [ENSMUST00000058232]
PDB Structure
Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030014
AA Change: V354A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: V354A

DomainStartEndE-ValueType
MIF4G 28 240 1.33e-38 SMART
Pfam:MIF4G_like 309 471 1.4e-37 PFAM
Pfam:MIF4G_like_2 485 754 4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058232
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131187
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Ncbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ncbp1 APN 4 46161307 missense probably damaging 1.00
IGL02085:Ncbp1 APN 4 46159699 missense probably damaging 0.96
IGL02230:Ncbp1 APN 4 46165272 missense probably benign 0.03
IGL02561:Ncbp1 APN 4 46159711 missense possibly damaging 0.80
IGL02574:Ncbp1 APN 4 46168449 critical splice acceptor site probably null
IGL03371:Ncbp1 APN 4 46171991 nonsense probably null
R0549:Ncbp1 UTSW 4 46168476 missense possibly damaging 0.69
R0594:Ncbp1 UTSW 4 46170551 missense probably benign 0.00
R0699:Ncbp1 UTSW 4 46147528 missense probably benign 0.17
R0725:Ncbp1 UTSW 4 46152056 missense probably benign 0.01
R0961:Ncbp1 UTSW 4 46165193 missense possibly damaging 0.69
R1330:Ncbp1 UTSW 4 46167354 missense probably benign 0.19
R1622:Ncbp1 UTSW 4 46171963 missense possibly damaging 0.60
R1756:Ncbp1 UTSW 4 46169131 nonsense probably null
R2417:Ncbp1 UTSW 4 46168530 missense probably benign 0.20
R4050:Ncbp1 UTSW 4 46147483 missense probably damaging 0.99
R4132:Ncbp1 UTSW 4 46169241 nonsense probably null
R4795:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4796:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4960:Ncbp1 UTSW 4 46165273 nonsense probably null
R5557:Ncbp1 UTSW 4 46165259 missense probably benign 0.01
R5626:Ncbp1 UTSW 4 46161290 missense probably damaging 1.00
R5682:Ncbp1 UTSW 4 46170474 unclassified probably benign
R5859:Ncbp1 UTSW 4 46163026 missense probably benign 0.00
R6377:Ncbp1 UTSW 4 46150703 missense probably damaging 1.00
R6440:Ncbp1 UTSW 4 46147516 missense probably damaging 1.00
R6793:Ncbp1 UTSW 4 46157827 missense probably damaging 0.99
R7078:Ncbp1 UTSW 4 46155756 missense probably benign 0.00
R7434:Ncbp1 UTSW 4 46149910 missense probably damaging 1.00
R7445:Ncbp1 UTSW 4 46149914 missense probably damaging 0.98
R7477:Ncbp1 UTSW 4 46157897 missense probably damaging 1.00
X0013:Ncbp1 UTSW 4 46150702 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGCATTTGTGTCAGCACTG -3'
(R):5'- GCTCCTACTGCAATCTTTTAAAAGC -3'

Sequencing Primer
(F):5'- CTCTAGCAGACTCTTGGTGTAGAAAG -3'
(R):5'- TGCAATCTTTTAAAAGCACAGCC -3'
Posted On2016-04-11