Incidental Mutation 'R4513:Hsd17b14'
ID377830
Institutional Source Beutler Lab
Gene Symbol Hsd17b14
Ensembl Gene ENSMUSG00000030825
Gene Namehydroxysteroid (17-beta) dehydrogenase 14
Synonyms0610039E24Rik, Dhrs10, retSDR3
MMRRC Submission 041759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4513 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45554893-45567752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45562915 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 124 (L124F)
Ref Sequence ENSEMBL: ENSMUSP00000147715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107752] [ENSMUST00000210300]
Predicted Effect probably benign
Transcript: ENSMUST00000107752
AA Change: L124F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825
AA Change: L124F

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115479
AA Change: L90F
Predicted Effect probably benign
Transcript: ENSMUST00000133242
AA Change: L124F

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121017
Gene: ENSMUSG00000030825
AA Change: L124F

DomainStartEndE-ValueType
Pfam:adh_short 10 163 9.9e-29 PFAM
Pfam:KR 10 177 2e-13 PFAM
Pfam:Epimerase 12 161 2.3e-8 PFAM
Pfam:3Beta_HSD 13 152 5.1e-7 PFAM
Pfam:adh_short_C2 16 159 4.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141247
AA Change: A125V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147958
AA Change: L34F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209745
Predicted Effect probably benign
Transcript: ENSMUST00000210300
AA Change: L124F

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210383
Predicted Effect probably benign
Transcript: ENSMUST00000210997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211029
Meta Mutation Damage Score 0.1310 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
PHENOTYPE: In a high-throughput phenotyping screen, male null mice exhibit infertility, decreased sperm production, testicular degeneration and an increased anxiety-like response to stress-induced hyperthermia. Homozygous null mice also show an increase in serum IgG2a in response to antigen challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Hsd17b14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hsd17b14 APN 7 45566713 missense possibly damaging 0.72
IGL02504:Hsd17b14 APN 7 45556375 missense possibly damaging 0.84
IGL03126:Hsd17b14 APN 7 45556079 missense possibly damaging 0.83
IGL03279:Hsd17b14 APN 7 45566193 missense possibly damaging 0.72
IGL03493:Hsd17b14 APN 7 45556091 missense probably damaging 1.00
R0085:Hsd17b14 UTSW 7 45556410 unclassified probably benign
R4128:Hsd17b14 UTSW 7 45563008 missense probably damaging 1.00
R5903:Hsd17b14 UTSW 7 45565962 missense probably damaging 1.00
R6649:Hsd17b14 UTSW 7 45556076 missense probably damaging 1.00
R6899:Hsd17b14 UTSW 7 45562928 missense possibly damaging 0.90
R7541:Hsd17b14 UTSW 7 45566146 missense probably damaging 1.00
R7829:Hsd17b14 UTSW 7 45566785 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCCTAGCTTGATGAGGACTGGAG -3'
(R):5'- ACATCAACTGCAGGGTTACC -3'

Sequencing Primer
(F):5'- CTTGATGAGGACTGGAGATGGAATAG -3'
(R):5'- GGGTTACCTTTCCCCTCAGAG -3'
Posted On2016-04-11