Incidental Mutation 'R4513:Adgre1'
ID377831
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 041759-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R4513 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57410947 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 320 (I320V)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: I320V

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: I320V

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: I320V

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: I320V

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGATATCGATGAGTGTGATGAC -3'
(R):5'- TACAGCTCCCCTTGCCAATG -3'

Sequencing Primer
(F):5'- AACACTATTGGGAGCTACTTCTGC -3'
(R):5'- GCCAATGCACTAAGACATTACTTTTG -3'
Posted On2016-04-11