Incidental Mutation 'R4288:Akr7a5'
ID377846
Institutional Source Beutler Lab
Gene Symbol Akr7a5
Ensembl Gene ENSMUSG00000028743
Gene Namealdo-keto reductase family 7, member A5 (aflatoxin aldehyde reductase)
Synonyms0610025K21Rik, Afar
MMRRC Submission 041653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4288 (G1)
Quality Score215
Status Validated
Chromosome4
Chromosomal Location139310744-139318426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139314104 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000073459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053862] [ENSMUST00000073787] [ENSMUST00000105801] [ENSMUST00000139840] [ENSMUST00000141007] [ENSMUST00000172747]
PDB Structure
MOUSE SUCCINIC SEMIALDEHYDE REDUCTASE, AKR7A5 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000053862
SMART Domains Protein: ENSMUSP00000059772
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073787
AA Change: V108A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073459
Gene: ENSMUSG00000028743
AA Change: V108A

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
Pfam:Aldo_ket_red 48 356 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105801
SMART Domains Protein: ENSMUSP00000101427
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139840
SMART Domains Protein: ENSMUSP00000121362
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153645
Predicted Effect probably benign
Transcript: ENSMUST00000172747
SMART Domains Protein: ENSMUSP00000134464
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Meta Mutation Damage Score 0.2423 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldo/keto reductase (AKR) superfamily and AKR7 family, which are involved in the detoxification of aldehydes and ketones. The AKR7 family consists of 3 genes that are present in a cluster on the p arm of chromosome 1. This protein, thought to be localized in the golgi, catalyzes the NADPH-dependent reduction of succinic semialdehyde to the endogenous neuromodulator, gamma-hydroxybutyrate. It may also function as a detoxication enzyme in the reduction of aflatoxin B1 and 2-carboxybenzaldehyde. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd G A 1: 127,738,572 V27M probably damaging Het
Acsl6 A G 11: 54,337,086 T311A probably benign Het
Adss G A 1: 177,776,512 R176W probably damaging Het
Atp13a1 A G 8: 69,794,078 D209G possibly damaging Het
Cdcp1 T A 9: 123,183,628 I285F probably damaging Het
Ctnna2 C T 6: 77,605,221 R339Q probably damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
E130308A19Rik G A 4: 59,690,308 M47I probably benign Het
Exosc9 C T 3: 36,563,216 T373I probably benign Het
Fam71e2 T A 7: 4,770,723 N58Y possibly damaging Het
Fat4 T A 3: 38,891,763 S1602T probably damaging Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fbxo42 T C 4: 141,167,896 Y57H probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Gpr37l1 A G 1: 135,161,184 V381A probably damaging Het
Hc G T 2: 35,030,402 A644E probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Impad1 A C 4: 4,778,231 V169G probably damaging Het
Lpar5 T C 6: 125,081,864 Y183H probably benign Het
Ltn1 T A 16: 87,397,988 N1341I possibly damaging Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Neb T G 2: 52,259,300 E2516D probably damaging Het
Parp4 T C 14: 56,607,494 V614A probably damaging Het
Pogk A G 1: 166,403,506 L84P probably damaging Het
Stard13 G A 5: 151,045,177 T994M probably damaging Het
Stk4 A G 2: 164,099,712 S283G probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r18 A G 6: 57,390,407 L54P probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Zyg11a C T 4: 108,184,469 S658N probably damaging Het
Other mutations in Akr7a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Akr7a5 APN 4 139314269 missense probably damaging 1.00
IGL02469:Akr7a5 APN 4 139314181 missense probably damaging 1.00
IGL03155:Akr7a5 APN 4 139314526 nonsense probably null
R1403:Akr7a5 UTSW 4 139318123 missense probably damaging 0.99
R1403:Akr7a5 UTSW 4 139318123 missense probably damaging 0.99
R4585:Akr7a5 UTSW 4 139310927 missense probably benign 0.09
R5067:Akr7a5 UTSW 4 139311022 missense probably damaging 1.00
R5293:Akr7a5 UTSW 4 139314206 missense probably benign 0.01
R6296:Akr7a5 UTSW 4 139318221 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTGCATGTCCAGTGAATAATTCTT -3'
(R):5'- GATGCAGCTGGTGGCAGG -3'

Sequencing Primer
(F):5'- TTTCTGAGACAGGGTTGGTTTCTC -3'
(R):5'- CTGGTGGCAGGCACGAAG -3'
Posted On2016-04-13