Incidental Mutation 'R4471:Mvp'
ID 377850
Institutional Source Beutler Lab
Gene Symbol Mvp
Ensembl Gene ENSMUSG00000030681
Gene Name major vault protein
Synonyms LRP, VAULT1, 2310009M24Rik
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 126986860-127014621 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) C to T at 127001958 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000127250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133172] [ENSMUST00000165096]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000133172
AA Change: M1I
SMART Domains Protein: ENSMUSP00000119213
Gene: ENSMUSG00000030681
AA Change: M1I

DomainStartEndE-ValueType
Pfam:Vault 25 64 3.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165096
AA Change: M1I
SMART Domains Protein: ENSMUSP00000127250
Gene: ENSMUSG00000030681
AA Change: M1I

DomainStartEndE-ValueType
Pfam:Vault 122 163 5.4e-18 PFAM
Pfam:Vault 175 215 7.7e-16 PFAM
Pfam:Vault 228 271 7.9e-14 PFAM
Pfam:Vault 333 377 2.8e-16 PFAM
Pfam:MVP_shoulder 528 656 5.9e-55 PFAM
low complexity region 707 720 N/A INTRINSIC
low complexity region 733 749 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172958
SMART Domains Protein: ENSMUSP00000134420
Gene: ENSMUSG00000092534

DomainStartEndE-ValueType
Pfam:PAXIP1_C 1 72 1.7e-30 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Targeted disruption of this gene does not induce hypersensitivity to various cytostatic agents. Homozygotes are viable, healthy and phenotypically normal and exhibit unimpaired dendritic cell maturation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Mvp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Mvp APN 7 126989687 missense probably benign 0.01
IGL01503:Mvp APN 7 127001961 splice site probably benign
IGL02043:Mvp APN 7 126993618 missense probably damaging 1.00
IGL03412:Mvp APN 7 126993563 missense probably damaging 1.00
R0148:Mvp UTSW 7 126989865 missense probably damaging 1.00
R0458:Mvp UTSW 7 126998491 missense probably damaging 1.00
R0811:Mvp UTSW 7 126987556 missense probably benign
R0812:Mvp UTSW 7 126987556 missense probably benign
R1625:Mvp UTSW 7 127001673 missense probably damaging 1.00
R1707:Mvp UTSW 7 127001572 missense probably benign
R1711:Mvp UTSW 7 126995735 critical splice donor site probably null
R1776:Mvp UTSW 7 126992761 missense probably benign 0.27
R3814:Mvp UTSW 7 126987629 missense probably benign
R4065:Mvp UTSW 7 126996317 missense probably damaging 1.00
R4273:Mvp UTSW 7 126989703 missense probably benign 0.16
R4652:Mvp UTSW 7 126993549 missense probably damaging 1.00
R4693:Mvp UTSW 7 126998328 missense probably damaging 0.98
R4972:Mvp UTSW 7 126989798 missense probably damaging 0.99
R5031:Mvp UTSW 7 126993616 nonsense probably null
R5530:Mvp UTSW 7 126995923 missense probably benign 0.45
R7053:Mvp UTSW 7 126987604 missense possibly damaging 0.90
R7324:Mvp UTSW 7 126993609 missense probably benign
R7580:Mvp UTSW 7 126992311 missense probably damaging 1.00
R8146:Mvp UTSW 7 126986999 missense probably benign 0.15
R9180:Mvp UTSW 7 126992650 missense probably benign 0.04
R9197:Mvp UTSW 7 126989787 missense probably damaging 0.99
R9351:Mvp UTSW 7 126996263 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAAGAGAAACCTCCCGG -3'
(R):5'- TGTAAGCAAGTACATATGACATGAAGT -3'

Sequencing Primer
(F):5'- GTCATTCCCACCAGCCAGG -3'
(R):5'- TTGGACTACCCTGCTTTG -3'
Posted On 2016-04-13