Incidental Mutation 'R4902:Mkks'
ID377855
Institutional Source Beutler Lab
Gene Symbol Mkks
Ensembl Gene ENSMUSG00000027274
Gene NameMcKusick-Kaufman syndrome
Synonyms1300013E18Rik, Bbs6
MMRRC Submission 042505-MU
Accession Numbers

Genbank: NM_021527; MGI: 1891836

Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location136873780-136891389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136876174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 396 (V396A)
Ref Sequence ENSEMBL: ENSMUSP00000105716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028730] [ENSMUST00000110089]
Predicted Effect probably benign
Transcript: ENSMUST00000028730
AA Change: V396A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028730
Gene: ENSMUSG00000027274
AA Change: V396A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 29 570 2.5e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110089
AA Change: V396A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105716
Gene: ENSMUSG00000027274
AA Change: V396A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 29 570 2.3e-90 PFAM
Meta Mutation Damage Score 0.2214 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene encodes a protein which shares sequence similarity with other members of the type II chaperonin family. The encoded protein is a centrosome-shuttling protein and plays an important role in cytokinesis. This protein also interacts with other type II chaperonin members to form a complex known as the BBSome, which involves ciliary membrane biogenesis. This protein is encoded by a downstream open reading frame (dORF). Several upstream open reading frames (uORFs) have been identified, which repress the translation of the dORF, and two of which can encode small mitochondrial membrane proteins. Alternatively spliced transcripts encoding distinct isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, retinal degeneration, obesity, increased food intake, hypoactivity, increased blood pressure, male infertility with the absence of flagella on spermatozoa, decreased aggression, and impaired olfaction but, do not display limb deformities. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Mkks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Mkks APN 2 136876170 missense probably damaging 1.00
D4043:Mkks UTSW 2 136874610 missense probably benign 0.01
R0183:Mkks UTSW 2 136880686 missense probably benign 0.01
R0193:Mkks UTSW 2 136877606 unclassified probably null
R1394:Mkks UTSW 2 136880962 missense probably damaging 1.00
R1765:Mkks UTSW 2 136880367 missense probably damaging 1.00
R4484:Mkks UTSW 2 136880574 missense probably benign 0.44
R4678:Mkks UTSW 2 136880281 missense probably benign 0.00
R4791:Mkks UTSW 2 136876162 missense probably benign 0.03
R4825:Mkks UTSW 2 136880655 missense probably benign 0.05
R5709:Mkks UTSW 2 136880736 missense probably benign 0.04
R6449:Mkks UTSW 2 136874286 missense probably damaging 0.98
R7021:Mkks UTSW 2 136876087 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTTCCTAGAGTATTATGATTTGGCC -3'
(R):5'- TCACTTTGTAGAACCCACATAGTG -3'

Sequencing Primer
(F):5'- TTGGCCATTGTCTCACAAAAC -3'
(R):5'- GACCTCTACGCATGTGTCCTGG -3'
Posted On2016-04-15