Incidental Mutation 'R4902:Ogfr'
ID377858
Institutional Source Beutler Lab
Gene Symbol Ogfr
Ensembl Gene ENSMUSG00000049401
Gene Nameopioid growth factor receptor
Synonyms2010013E17Rik
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180589245-180595836 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 180593725 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029087] [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect probably benign
Transcript: ENSMUST00000029087
SMART Domains Protein: ENSMUSP00000029087
Gene: ENSMUSG00000049401

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
Pfam:OGFr_N 76 283 2.3e-111 PFAM
low complexity region 358 369 N/A INTRINSIC
internal_repeat_1 459 483 4.08e-5 PROSPERO
internal_repeat_1 576 600 4.08e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103059
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147070
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Ogfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ogfr APN 2 180593562 unclassified probably benign
IGL02437:Ogfr APN 2 180589536 missense possibly damaging 0.72
IGL02602:Ogfr APN 2 180595437 missense possibly damaging 0.85
IGL02609:Ogfr APN 2 180592515 splice site probably benign
IGL03297:Ogfr APN 2 180594407 missense possibly damaging 0.93
PIT4812001:Ogfr UTSW 2 180595511 missense possibly damaging 0.93
R0085:Ogfr UTSW 2 180591037 synonymous probably null
R0398:Ogfr UTSW 2 180593699 missense probably damaging 0.99
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R4747:Ogfr UTSW 2 180594423 missense probably damaging 0.99
R5422:Ogfr UTSW 2 180595274 missense possibly damaging 0.63
R5422:Ogfr UTSW 2 180595275 missense probably benign 0.02
R5860:Ogfr UTSW 2 180592492 missense probably damaging 1.00
R5988:Ogfr UTSW 2 180594233 missense probably damaging 1.00
R6015:Ogfr UTSW 2 180594674 missense probably damaging 1.00
R6558:Ogfr UTSW 2 180595404 missense possibly damaging 0.93
R6721:Ogfr UTSW 2 180595428 missense possibly damaging 0.70
R7111:Ogfr UTSW 2 180595266 unclassified probably benign
R7201:Ogfr UTSW 2 180595094 unclassified probably benign
R7217:Ogfr UTSW 2 180595266 unclassified probably benign
R7243:Ogfr UTSW 2 180595266 unclassified probably benign
R7387:Ogfr UTSW 2 180595266 unclassified probably benign
R7563:Ogfr UTSW 2 180592507 critical splice donor site probably null
R7681:Ogfr UTSW 2 180595266 unclassified probably benign
R7844:Ogfr UTSW 2 180595057 unclassified probably benign
R7845:Ogfr UTSW 2 180595266 unclassified probably benign
R7848:Ogfr UTSW 2 180592433 missense probably damaging 1.00
R7931:Ogfr UTSW 2 180592433 missense probably damaging 1.00
R8011:Ogfr UTSW 2 180595266 unclassified probably benign
R8039:Ogfr UTSW 2 180595266 unclassified probably benign
R8045:Ogfr UTSW 2 180595057 unclassified probably benign
RF022:Ogfr UTSW 2 180595266 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGGGAACAGTGATGAGTG -3'
(R):5'- AAGCCAAGGAACTGCTTTGTCC -3'

Sequencing Primer
(F):5'- TGATGAGTGAGGGCCACC -3'
(R):5'- AAGGAACTGCTTTGTCCATCAC -3'
Posted On2016-04-15