Incidental Mutation 'R4902:Steap2'
ID377865
Institutional Source Beutler Lab
Gene Symbol Steap2
Ensembl Gene ENSMUSG00000015653
Gene Namesix transmembrane epithelial antigen of prostate 2
Synonyms
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5664829-5694578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5675866 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 386 (N386S)
Ref Sequence ENSEMBL: ENSMUSP00000132501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015797] [ENSMUST00000115424] [ENSMUST00000115425] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000148333] [ENSMUST00000164219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015797
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015797
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.9e-19 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 405 2.8e-16 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115424
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111084
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115425
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111085
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115426
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115427
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148333
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116910
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.3e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 2.7e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150238
Predicted Effect possibly damaging
Transcript: ENSMUST00000164219
AA Change: N386S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653
AA Change: N386S

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Meta Mutation Damage Score 0.1138 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the STEAP family and encodes a multi-pass membrane protein that localizes to the Golgi complex, the plasma membrane, and the vesicular tubular structures in the cytosol. A highly similar protein in mouse has both ferrireductase and cupric reductase activity, and stimulates the cellular uptake of both iron and copper in vitro. Increased transcriptional expression of the human gene is associated with prostate cancer progression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Steap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Steap2 APN 5 5673586 missense probably damaging 0.99
IGL02272:Steap2 APN 5 5677612 missense probably benign 0.10
IGL02680:Steap2 APN 5 5673474 missense probably benign 0.00
R0267:Steap2 UTSW 5 5673561 missense probably benign 0.00
R1670:Steap2 UTSW 5 5677393 missense possibly damaging 0.80
R2175:Steap2 UTSW 5 5673501 missense probably damaging 1.00
R2188:Steap2 UTSW 5 5673643 nonsense probably null
R2374:Steap2 UTSW 5 5675845 missense probably damaging 0.99
R4941:Steap2 UTSW 5 5677651 missense probably damaging 1.00
R5012:Steap2 UTSW 5 5677784 missense possibly damaging 0.48
R5555:Steap2 UTSW 5 5677544 missense possibly damaging 0.89
R5571:Steap2 UTSW 5 5675912 missense probably damaging 1.00
R5666:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5670:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5677:Steap2 UTSW 5 5677497 nonsense probably null
R6101:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6105:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6190:Steap2 UTSW 5 5675881 missense probably damaging 1.00
R7172:Steap2 UTSW 5 5682896 missense possibly damaging 0.52
R7576:Steap2 UTSW 5 5677406 missense probably benign 0.01
R7706:Steap2 UTSW 5 5682967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTAATGATGTACTGGCCTTTCAC -3'
(R):5'- GTGCAGAGTCAGCGAACATTC -3'

Sequencing Primer
(F):5'- CACTTACTAAACTGGCCTTTAGGTAC -3'
(R):5'- GTCAGCGAACATTCTACCGAGTAG -3'
Posted On2016-04-15