Incidental Mutation 'R4902:Fry'
ID377870
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150495703 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 2871 (M2871L)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably benign
Transcript: ENSMUST00000087204
AA Change: M2871L

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: M2871L

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200863
AA Change: M503L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202386
Predicted Effect probably benign
Transcript: ENSMUST00000202566
AA Change: M867L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: M867L

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202571
Meta Mutation Damage Score 0.1180 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R8058:Fry UTSW 5 150495767 missense
R8070:Fry UTSW 5 150478007 missense
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACACTTGCCAATGGGGTTTTG -3'
(R):5'- GCACTCTTTGATCTGCCTCAGG -3'

Sequencing Primer
(F):5'- TAACCTCACTGGGTAGCCTAG -3'
(R):5'- AAGGTTGGTTCTGACCAC -3'
Posted On2016-04-15