Incidental Mutation 'R4902:Met'
ID377871
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17546996 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 876 (V876A)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: V876A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: V876A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: V876A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: V876A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: V876A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: V876A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148903
AA Change: V8A
SMART Domains Protein: ENSMUSP00000121923
Gene: ENSMUSG00000009376
AA Change: V8A

DomainStartEndE-ValueType
Blast:IPT 2 64 1e-37 BLAST
low complexity region 65 83 N/A INTRINSIC
PDB:3VW8|A 108 157 5e-23 PDB
Predicted Effect unknown
Transcript: ENSMUST00000152802
AA Change: V156A
SMART Domains Protein: ENSMUSP00000118755
Gene: ENSMUSG00000009376
AA Change: V156A

DomainStartEndE-ValueType
IPT 21 116 3.38e-16 SMART
IPT 118 202 4.34e-5 SMART
Meta Mutation Damage Score 0.5386 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATTTCTTGGAAAACAGCG -3'
(R):5'- ACTGAGGCTGAGCTGATGAG -3'

Sequencing Primer
(F):5'- TCTTGGAAAACAGCGTCTGC -3'
(R):5'- GCTGATGAGCTAGAGCCAACATAC -3'
Posted On2016-04-15