Incidental Mutation 'R4902:Nfkbib'
ID377875
Institutional Source Beutler Lab
Gene Symbol Nfkbib
Ensembl Gene ENSMUSG00000030595
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
SynonymsIKappaBbeta, IkB
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28758251-28767512 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 28761748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 158 (S158*)
Ref Sequence ENSEMBL: ENSMUSP00000083012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032815] [ENSMUST00000085851] [ENSMUST00000122915] [ENSMUST00000137121] [ENSMUST00000178767]
Predicted Effect probably null
Transcript: ENSMUST00000032815
AA Change: S158*
SMART Domains Protein: ENSMUSP00000032815
Gene: ENSMUSG00000030595
AA Change: S158*

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085851
AA Change: S158*
SMART Domains Protein: ENSMUSP00000083012
Gene: ENSMUSG00000030595
AA Change: S158*

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122915
Predicted Effect probably benign
Transcript: ENSMUST00000137121
SMART Domains Protein: ENSMUSP00000117769
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 151 2.15e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178767
SMART Domains Protein: ENSMUSP00000137487
Gene: ENSMUSG00000096257

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
coiled coil region 228 270 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kappaB). The encoded protein prevents NF-kappaB-mediated transcription activation by sequestering it in the cytosol. In response to signals that induce NF-kappaB, such as cytokines and growth factors, the encoded protein undergoes phosphorylation, triggering its rapid ubiquitination and proteasomal degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased susceptibility to endotoxin shock and induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Nfkbib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Nfkbib APN 7 28761709 missense probably benign 0.00
IGL02006:Nfkbib APN 7 28766242 critical splice donor site probably null
IGL02327:Nfkbib APN 7 28759143 missense probably benign 0.14
IGL02342:Nfkbib APN 7 28762103 missense probably damaging 1.00
IGL02610:Nfkbib APN 7 28759849 missense probably damaging 0.99
R0574:Nfkbib UTSW 7 28761788 missense probably benign 0.28
R1470:Nfkbib UTSW 7 28762022 splice site probably null
R1730:Nfkbib UTSW 7 28762055 missense probably damaging 1.00
R1783:Nfkbib UTSW 7 28762055 missense probably damaging 1.00
R7291:Nfkbib UTSW 7 28759203 missense possibly damaging 0.62
R7297:Nfkbib UTSW 7 28766343 missense probably benign 0.07
R7890:Nfkbib UTSW 7 28762087 missense probably damaging 1.00
R7973:Nfkbib UTSW 7 28762087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTGGCTACAACTCAGG -3'
(R):5'- ATCCTTGGGGAGGCATCTAC -3'

Sequencing Primer
(F):5'- TGGCCAGGAGCTCACATCTTC -3'
(R):5'- CCTTGGGGAGGCATCTACAGTAG -3'
Posted On2016-04-15