Incidental Mutation 'R4902:Myo5a'
ID377887
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75174078 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 982 (T982A)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
Predicted Effect probably benign
Transcript: ENSMUST00000123128
AA Change: T982A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: T982A

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably benign
Transcript: ENSMUST00000136731
AA Change: T982A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: T982A

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155282
AA Change: T982A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: T982A

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
R7620:Myo5a UTSW 9 75164136 missense probably benign 0.41
R7719:Myo5a UTSW 9 75144084 missense probably benign 0.01
R7810:Myo5a UTSW 9 75160465 missense probably benign 0.09
R7810:Myo5a UTSW 9 75169010 missense probably benign
R7866:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R7949:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R8050:Myo5a UTSW 9 75181946 missense probably damaging 0.99
R8061:Myo5a UTSW 9 75122957 nonsense probably null
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75186036 missense
Predicted Primers PCR Primer
(F):5'- CCTCACTGCATACATTTGGC -3'
(R):5'- TATAGACTCACTTGGACTAGGTCAGG -3'

Sequencing Primer
(F):5'- ACTGCATACATTTGGCCAGTC -3'
(R):5'- TCACTTGGACTAGGTCAGGACTAC -3'
Posted On2016-04-15