Incidental Mutation 'R4902:Gprc5c'
ID377893
Institutional Source Beutler Lab
Gene Symbol Gprc5c
Ensembl Gene ENSMUSG00000051043
Gene NameG protein-coupled receptor, family C, group 5, member C
Synonyms
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114851152-114872617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114864267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 257 (V257L)
Ref Sequence ENSEMBL: ENSMUSP00000061760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 60 301 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122967
SMART Domains Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133245
SMART Domains Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 283 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142262
SMART Domains Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 133 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152314
Predicted Effect possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Tmem50a A G 4: 134,909,706 I38T probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Gprc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Gprc5c APN 11 114864252 missense probably benign 0.01
IGL01762:Gprc5c APN 11 114864024 missense probably benign 0.28
IGL02039:Gprc5c APN 11 114864486 nonsense probably null
R0800:Gprc5c UTSW 11 114866711 missense probably damaging 0.99
R1618:Gprc5c UTSW 11 114864394 missense possibly damaging 0.88
R4198:Gprc5c UTSW 11 114863860 missense probably damaging 1.00
R4807:Gprc5c UTSW 11 114864498 missense probably damaging 0.97
R4846:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4904:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5016:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5048:Gprc5c UTSW 11 114870351 makesense probably null
R5106:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5109:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5173:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5266:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5267:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5475:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5508:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5557:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5562:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5563:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5598:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5599:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5729:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5756:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5792:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5793:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5794:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5817:Gprc5c UTSW 11 114863624 nonsense probably null
R5976:Gprc5c UTSW 11 114864487 missense possibly damaging 0.89
R6151:Gprc5c UTSW 11 114864025 missense probably damaging 1.00
R6617:Gprc5c UTSW 11 114864105 missense probably benign 0.05
R7108:Gprc5c UTSW 11 114864282 missense probably damaging 1.00
R7191:Gprc5c UTSW 11 114868617 missense possibly damaging 0.56
R7796:Gprc5c UTSW 11 114864532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- CCTTCAGGATGGTCTCATAGC -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- AGGATGGTCTCATAGCCCACC -3'
Posted On2016-04-15