Incidental Mutation 'R4903:Dars2'
ID377920
Institutional Source Beutler Lab
Gene Symbol Dars2
Ensembl Gene ENSMUSG00000026709
Gene Nameaspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms5830468K18Rik
MMRRC Submission 042506-MU
Accession Numbers

Ncbi RefSeq: NM_172644.3; MGI: 2442510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161040601-161070658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 161051371 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 362 (P362R)
Ref Sequence ENSEMBL: ENSMUSP00000041851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035430]
Predicted Effect probably benign
Transcript: ENSMUST00000035430
AA Change: P362R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041851
Gene: ENSMUSG00000026709
AA Change: P362R

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 65 148 7e-10 PFAM
Pfam:tRNA-synt_2 165 607 1.2e-90 PFAM
Pfam:GAD 355 451 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162654
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Dars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Dars2 UTSW 1 161053939 critical splice donor site probably null
R0230:Dars2 UTSW 1 161062787 missense probably benign 0.02
R0537:Dars2 UTSW 1 161060748 missense possibly damaging 0.46
R0709:Dars2 UTSW 1 161046928 missense probably benign 0.00
R1365:Dars2 UTSW 1 161044994 nonsense probably null
R1502:Dars2 UTSW 1 161046805 nonsense probably null
R1625:Dars2 UTSW 1 161054044 missense possibly damaging 0.88
R1934:Dars2 UTSW 1 161063241 splice site probably null
R2239:Dars2 UTSW 1 161063282 missense possibly damaging 0.83
R3721:Dars2 UTSW 1 161063308 missense probably benign 0.03
R4308:Dars2 UTSW 1 161041721 missense probably damaging 0.98
R4786:Dars2 UTSW 1 161060760 missense probably damaging 1.00
R4859:Dars2 UTSW 1 161044990 missense probably damaging 0.99
R5042:Dars2 UTSW 1 161045094 intron probably benign
R5068:Dars2 UTSW 1 161041913 missense probably benign 0.02
R6257:Dars2 UTSW 1 161041828 missense probably damaging 1.00
R7286:Dars2 UTSW 1 161046808 missense possibly damaging 0.85
R7346:Dars2 UTSW 1 161046772 splice site probably null
R7444:Dars2 UTSW 1 161046884 missense possibly damaging 0.94
R7593:Dars2 UTSW 1 161057543 missense probably damaging 1.00
R7845:Dars2 UTSW 1 161041748 missense probably benign 0.00
X0063:Dars2 UTSW 1 161056493 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCTGGCATCTCTTTTAAAATGGTA -3'
(R):5'- GTGCAAATGTAATACACCACCACATA -3'

Sequencing Primer
(F):5'- GTGTAACTCTGACTGGCCTAGAAC -3'
(R):5'- TGTAATACACCACCACATACACAGG -3'
Posted On2016-04-15