Incidental Mutation 'R4903:Dnah10'
ID 377936
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Name dynein, axonemal, heavy chain 10
Synonyms Dnahc10
MMRRC Submission 042506-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4903 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124802149-124911372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124894812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3459 (E3459G)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000058440
AA Change: E3516G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: E3516G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141137
AA Change: E3459G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: E3459G

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197269
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,645,119 (GRCm39) E335* probably null Het
Abca9 A G 11: 110,037,827 (GRCm39) Y508H probably damaging Het
Abcc9 A T 6: 142,546,691 (GRCm39) L1347H probably damaging Het
Acox3 A G 5: 35,747,080 (GRCm39) N166D probably damaging Het
Adam5 T C 8: 25,276,248 (GRCm39) Y473C probably damaging Het
Agbl2 A G 2: 90,627,817 (GRCm39) I207M possibly damaging Het
Akna C A 4: 63,292,274 (GRCm39) R1130S probably damaging Het
Alg12 A T 15: 88,698,743 (GRCm39) I194N probably damaging Het
Alk T A 17: 72,176,558 (GRCm39) H1582L probably damaging Het
Atn1 G C 6: 124,720,220 (GRCm39) probably benign Het
Carhsp1 T C 16: 8,478,864 (GRCm39) T130A probably damaging Het
Chrna3 T C 9: 54,922,810 (GRCm39) T333A probably benign Het
Ctsr T A 13: 61,310,945 (GRCm39) I34L probably benign Het
Cxcl16 A G 11: 70,346,519 (GRCm39) V208A probably benign Het
Dars2 G C 1: 160,878,941 (GRCm39) P362R probably benign Het
Dus2 G A 8: 106,771,437 (GRCm39) D188N probably benign Het
Ece2 C T 16: 20,449,972 (GRCm39) R189* probably null Het
Egfr A T 11: 16,858,949 (GRCm39) D976V probably damaging Het
Egr2 T A 10: 67,374,163 (GRCm39) I51N probably damaging Het
Exoc3l4 A G 12: 111,395,155 (GRCm39) H591R probably benign Het
G2e3 A G 12: 51,418,413 (GRCm39) I603V probably benign Het
Gm11564 A C 11: 99,705,858 (GRCm39) C191G unknown Het
Gpatch8 A G 11: 102,370,959 (GRCm39) S860P unknown Het
Gprin1 C G 13: 54,885,742 (GRCm39) W844S probably damaging Het
Hhipl2 T A 1: 183,207,698 (GRCm39) Y252* probably null Het
Hormad1 T A 3: 95,492,531 (GRCm39) probably null Het
Hrg A G 16: 22,779,901 (GRCm39) probably benign Het
Hsh2d C T 8: 72,947,372 (GRCm39) A23V probably benign Het
Ints6 A G 14: 62,939,911 (GRCm39) L593P probably damaging Het
Jak2 A G 19: 29,252,436 (GRCm39) S129G probably benign Het
Kif1a C T 1: 92,949,456 (GRCm39) E1579K probably damaging Het
Lhcgr A T 17: 89,049,789 (GRCm39) I579N probably damaging Het
Lrig3 A T 10: 125,832,482 (GRCm39) probably null Het
Man2c1 C A 9: 57,046,240 (GRCm39) Q465K probably benign Het
Map3k5 T A 10: 19,994,235 (GRCm39) L1043Q probably null Het
Map4k1 A T 7: 28,682,427 (GRCm39) H16L probably benign Het
Mapk8ip3 A G 17: 25,120,183 (GRCm39) S946P probably benign Het
Mrpl50 T C 4: 49,514,488 (GRCm39) Y61C probably damaging Het
Myf5 A T 10: 107,321,733 (GRCm39) C20* probably null Het
Nek11 T C 9: 105,191,921 (GRCm39) K163R possibly damaging Het
Or1l4b A T 2: 37,036,383 (GRCm39) H53L probably benign Het
Or4c105 A T 2: 88,648,342 (GRCm39) I276L probably benign Het
Pcdhga9 C A 18: 37,872,058 (GRCm39) T629K probably damaging Het
Pglyrp1 A G 7: 18,624,128 (GRCm39) N137S probably benign Het
Pip5k1a T C 3: 94,978,094 (GRCm39) I275V probably benign Het
Pitpnm2 T A 5: 124,290,668 (GRCm39) Y6F probably damaging Het
Pkd1 T G 17: 24,790,976 (GRCm39) V1057G probably benign Het
Plcb3 C A 19: 6,933,211 (GRCm39) R970L probably damaging Het
Plekha5 T A 6: 140,532,093 (GRCm39) M586K probably damaging Het
Ppp4r4 T A 12: 103,557,030 (GRCm39) probably null Het
Rasal3 C T 17: 32,616,357 (GRCm39) C278Y probably damaging Het
Rbm34 T C 8: 127,678,087 (GRCm39) D269G possibly damaging Het
Rnf32 G A 5: 29,403,576 (GRCm39) R7H probably benign Het
Sema3d A G 5: 12,613,125 (GRCm39) K401E probably benign Het
Sema7a T C 9: 57,862,378 (GRCm39) Y194H probably benign Het
Senp5 A T 16: 31,802,117 (GRCm39) Y585N probably damaging Het
Serpinb9 T A 13: 33,192,847 (GRCm39) W135R probably damaging Het
Shbg C T 11: 69,505,912 (GRCm39) S365N probably benign Het
Slc39a6 A T 18: 24,730,925 (GRCm39) S65T probably damaging Het
Stk3 T C 15: 34,959,212 (GRCm39) E320G probably damaging Het
Syk T A 13: 52,765,117 (GRCm39) H81Q probably damaging Het
Tet1 A G 10: 62,658,437 (GRCm39) W1470R probably damaging Het
Thada C A 17: 84,559,828 (GRCm39) V1450L possibly damaging Het
Tmem241 A G 18: 12,237,176 (GRCm39) S87P probably damaging Het
Trdv1 T A 14: 54,119,375 (GRCm39) probably benign Het
Trim40 T C 17: 37,194,117 (GRCm39) E192G possibly damaging Het
Trip11 A T 12: 101,853,065 (GRCm39) probably null Het
Trmt2a T A 16: 18,067,418 (GRCm39) C30* probably null Het
Tshr A G 12: 91,367,962 (GRCm39) D35G probably benign Het
Tssc4 T C 7: 142,624,322 (GRCm39) V210A probably damaging Het
Ttk T A 9: 83,747,201 (GRCm39) I680N probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl4a T C 18: 80,250,493 (GRCm39) F30L probably damaging Het
Ubac2 G T 14: 122,231,650 (GRCm39) C192F probably benign Het
Vmn1r12 A G 6: 57,136,502 (GRCm39) T156A possibly damaging Het
Zfp747l1 T A 7: 126,984,578 (GRCm39) T175S probably benign Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124,905,667 (GRCm39) missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124,823,680 (GRCm39) missense probably benign 0.01
IGL00471:Dnah10 APN 5 124,871,405 (GRCm39) missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124,852,576 (GRCm39) missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124,854,276 (GRCm39) missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124,856,218 (GRCm39) missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124,861,010 (GRCm39) missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124,898,405 (GRCm39) missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124,809,553 (GRCm39) missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124,880,392 (GRCm39) missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124,864,529 (GRCm39) missense probably benign 0.10
IGL01757:Dnah10 APN 5 124,845,991 (GRCm39) missense probably benign 0.37
IGL01759:Dnah10 APN 5 124,832,850 (GRCm39) missense probably benign
IGL01767:Dnah10 APN 5 124,820,801 (GRCm39) splice site probably benign
IGL01769:Dnah10 APN 5 124,842,008 (GRCm39) missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124,860,985 (GRCm39) missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124,866,876 (GRCm39) missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124,881,810 (GRCm39) missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124,896,430 (GRCm39) missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124,910,487 (GRCm39) critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124,850,131 (GRCm39) missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124,850,883 (GRCm39) missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124,866,860 (GRCm39) missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124,870,916 (GRCm39) missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124,898,351 (GRCm39) missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124,864,395 (GRCm39) missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124,876,069 (GRCm39) missense probably benign 0.26
IGL02709:Dnah10 APN 5 124,850,809 (GRCm39) nonsense probably null
IGL02740:Dnah10 APN 5 124,903,927 (GRCm39) splice site probably benign
IGL02746:Dnah10 APN 5 124,807,150 (GRCm39) missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124,875,078 (GRCm39) missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124,878,886 (GRCm39) missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124,840,197 (GRCm39) missense probably benign 0.07
IGL03076:Dnah10 APN 5 124,807,226 (GRCm39) critical splice donor site probably null
IGL03109:Dnah10 APN 5 124,841,950 (GRCm39) missense probably benign 0.10
IGL03181:Dnah10 APN 5 124,825,521 (GRCm39) missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124,894,707 (GRCm39) missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124,894,761 (GRCm39) missense probably benign 0.00
IGL03328:Dnah10 APN 5 124,831,354 (GRCm39) missense probably benign 0.06
frosty UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124,906,593 (GRCm39) missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124,807,164 (GRCm39) missense probably benign
P0019:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
P0037:Dnah10 UTSW 5 124,895,056 (GRCm39) nonsense probably null
PIT4366001:Dnah10 UTSW 5 124,852,588 (GRCm39) missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124,803,966 (GRCm39) missense probably benign
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124,907,808 (GRCm39) missense probably benign 0.00
R0066:Dnah10 UTSW 5 124,840,140 (GRCm39) missense probably benign 0.01
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124,911,139 (GRCm39) missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124,873,433 (GRCm39) splice site probably benign
R0321:Dnah10 UTSW 5 124,900,416 (GRCm39) missense probably benign 0.29
R0410:Dnah10 UTSW 5 124,832,799 (GRCm39) missense probably benign
R0480:Dnah10 UTSW 5 124,885,915 (GRCm39) missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124,889,787 (GRCm39) critical splice donor site probably null
R0533:Dnah10 UTSW 5 124,852,314 (GRCm39) splice site probably null
R0599:Dnah10 UTSW 5 124,878,017 (GRCm39) missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124,827,876 (GRCm39) missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124,906,641 (GRCm39) missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124,875,002 (GRCm39) missense probably benign 0.00
R1203:Dnah10 UTSW 5 124,837,078 (GRCm39) splice site probably null
R1248:Dnah10 UTSW 5 124,832,887 (GRCm39) splice site probably benign
R1366:Dnah10 UTSW 5 124,830,390 (GRCm39) missense probably benign 0.41
R1434:Dnah10 UTSW 5 124,852,050 (GRCm39) missense probably benign 0.03
R1436:Dnah10 UTSW 5 124,839,285 (GRCm39) missense probably benign 0.00
R1438:Dnah10 UTSW 5 124,876,009 (GRCm39) missense probably benign 0.25
R1446:Dnah10 UTSW 5 124,866,860 (GRCm39) missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124,820,750 (GRCm39) missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1479:Dnah10 UTSW 5 124,854,953 (GRCm39) missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124,831,303 (GRCm39) missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124,838,016 (GRCm39) missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124,906,678 (GRCm39) missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124,842,626 (GRCm39) missense probably benign 0.00
R1709:Dnah10 UTSW 5 124,837,155 (GRCm39) missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124,850,254 (GRCm39) splice site probably null
R1828:Dnah10 UTSW 5 124,838,343 (GRCm39) missense probably benign 0.00
R1854:Dnah10 UTSW 5 124,881,753 (GRCm39) missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124,909,590 (GRCm39) splice site probably null
R1893:Dnah10 UTSW 5 124,831,381 (GRCm39) missense probably benign 0.13
R1895:Dnah10 UTSW 5 124,835,494 (GRCm39) missense probably benign 0.00
R1906:Dnah10 UTSW 5 124,878,048 (GRCm39) missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124,859,332 (GRCm39) missense probably benign 0.00
R1965:Dnah10 UTSW 5 124,852,267 (GRCm39) missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124,911,052 (GRCm39) missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124,906,651 (GRCm39) missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124,823,768 (GRCm39) missense probably benign 0.30
R2046:Dnah10 UTSW 5 124,873,405 (GRCm39) missense probably benign 0.25
R2074:Dnah10 UTSW 5 124,891,738 (GRCm39) missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124,852,045 (GRCm39) missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124,838,301 (GRCm39) missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124,808,530 (GRCm39) missense probably benign 0.00
R2293:Dnah10 UTSW 5 124,896,285 (GRCm39) missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124,819,064 (GRCm39) missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124,839,929 (GRCm39) critical splice donor site probably null
R2571:Dnah10 UTSW 5 124,852,542 (GRCm39) missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124,894,734 (GRCm39) missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124,896,476 (GRCm39) critical splice donor site probably null
R3439:Dnah10 UTSW 5 124,873,322 (GRCm39) missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124,824,694 (GRCm39) missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124,850,095 (GRCm39) missense probably benign 0.37
R4015:Dnah10 UTSW 5 124,854,990 (GRCm39) missense probably benign 0.25
R4261:Dnah10 UTSW 5 124,807,201 (GRCm39) missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124,809,394 (GRCm39) missense probably benign 0.28
R4299:Dnah10 UTSW 5 124,896,989 (GRCm39) missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124,839,933 (GRCm39) splice site probably null
R4651:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4652:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4664:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124,852,581 (GRCm39) missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124,824,809 (GRCm39) missense probably benign 0.01
R4806:Dnah10 UTSW 5 124,896,408 (GRCm39) missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124,850,196 (GRCm39) missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124,839,260 (GRCm39) missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124,909,577 (GRCm39) missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5119:Dnah10 UTSW 5 124,856,322 (GRCm39) missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124,876,024 (GRCm39) missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124,864,484 (GRCm39) missense probably benign 0.00
R5262:Dnah10 UTSW 5 124,862,220 (GRCm39) missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124,868,851 (GRCm39) missense probably benign 0.01
R5322:Dnah10 UTSW 5 124,850,630 (GRCm39) missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124,820,693 (GRCm39) missense probably benign 0.16
R5468:Dnah10 UTSW 5 124,907,557 (GRCm39) missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124,830,232 (GRCm39) missense probably benign
R5587:Dnah10 UTSW 5 124,870,977 (GRCm39) missense probably benign 0.10
R5724:Dnah10 UTSW 5 124,819,090 (GRCm39) missense probably benign 0.27
R5797:Dnah10 UTSW 5 124,898,450 (GRCm39) missense probably benign 0.00
R5812:Dnah10 UTSW 5 124,824,810 (GRCm39) missense probably benign 0.01
R5846:Dnah10 UTSW 5 124,900,437 (GRCm39) missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R5961:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5970:Dnah10 UTSW 5 124,885,793 (GRCm39) missense probably benign
R6021:Dnah10 UTSW 5 124,814,048 (GRCm39) missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124,878,924 (GRCm39) missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124,896,274 (GRCm39) missense probably benign 0.09
R6080:Dnah10 UTSW 5 124,882,961 (GRCm39) missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124,830,238 (GRCm39) missense probably benign 0.18
R6155:Dnah10 UTSW 5 124,862,239 (GRCm39) missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124,847,663 (GRCm39) missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124,900,382 (GRCm39) missense probably benign 0.02
R6238:Dnah10 UTSW 5 124,820,743 (GRCm39) missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124,871,283 (GRCm39) splice site probably null
R6275:Dnah10 UTSW 5 124,862,248 (GRCm39) missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124,852,144 (GRCm39) missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124,906,710 (GRCm39) missense probably benign 0.00
R6458:Dnah10 UTSW 5 124,886,333 (GRCm39) missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124,839,846 (GRCm39) missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124,835,419 (GRCm39) missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124,907,097 (GRCm39) missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124,837,223 (GRCm39) missense probably benign 0.45
R6702:Dnah10 UTSW 5 124,882,869 (GRCm39) missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124,885,876 (GRCm39) missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124,854,890 (GRCm39) missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124,867,064 (GRCm39) splice site probably null
R6932:Dnah10 UTSW 5 124,898,514 (GRCm39) missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124,864,490 (GRCm39) missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124,893,206 (GRCm39) missense probably benign 0.37
R7138:Dnah10 UTSW 5 124,900,009 (GRCm39) missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124,900,006 (GRCm39) missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124,890,892 (GRCm39) missense probably benign 0.19
R7278:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R7284:Dnah10 UTSW 5 124,909,662 (GRCm39) missense probably benign 0.37
R7322:Dnah10 UTSW 5 124,898,333 (GRCm39) missense probably benign 0.08
R7523:Dnah10 UTSW 5 124,824,803 (GRCm39) missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124,876,095 (GRCm39) missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124,823,608 (GRCm39) missense probably benign 0.21
R7606:Dnah10 UTSW 5 124,894,776 (GRCm39) missense probably benign 0.00
R7835:Dnah10 UTSW 5 124,854,298 (GRCm39) missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124,859,425 (GRCm39) missense probably damaging 1.00
R7972:Dnah10 UTSW 5 124,803,949 (GRCm39) missense probably benign
R7999:Dnah10 UTSW 5 124,802,322 (GRCm39) missense probably benign 0.06
R8017:Dnah10 UTSW 5 124,877,949 (GRCm39) missense probably benign 0.03
R8032:Dnah10 UTSW 5 124,823,676 (GRCm39) missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124,905,575 (GRCm39) missense probably benign 0.00
R8088:Dnah10 UTSW 5 124,831,330 (GRCm39) missense probably benign 0.00
R8169:Dnah10 UTSW 5 124,877,946 (GRCm39) missense probably damaging 1.00
R8178:Dnah10 UTSW 5 124,832,790 (GRCm39) missense probably benign 0.11
R8200:Dnah10 UTSW 5 124,905,524 (GRCm39) missense probably damaging 1.00
R8210:Dnah10 UTSW 5 124,827,858 (GRCm39) missense probably benign 0.29
R8294:Dnah10 UTSW 5 124,859,410 (GRCm39) missense probably damaging 1.00
R8338:Dnah10 UTSW 5 124,909,566 (GRCm39) missense probably damaging 1.00
R8404:Dnah10 UTSW 5 124,850,606 (GRCm39) missense probably damaging 1.00
R8469:Dnah10 UTSW 5 124,813,895 (GRCm39) missense probably damaging 1.00
R8537:Dnah10 UTSW 5 124,893,164 (GRCm39) missense probably damaging 0.97
R8701:Dnah10 UTSW 5 124,803,911 (GRCm39) missense probably benign 0.00
R8723:Dnah10 UTSW 5 124,891,685 (GRCm39) missense probably damaging 0.99
R8770:Dnah10 UTSW 5 124,852,410 (GRCm39) missense possibly damaging 0.94
R8838:Dnah10 UTSW 5 124,842,614 (GRCm39) missense probably benign 0.09
R8879:Dnah10 UTSW 5 124,895,181 (GRCm39) missense probably damaging 1.00
R8928:Dnah10 UTSW 5 124,866,828 (GRCm39) missense probably damaging 0.98
R8932:Dnah10 UTSW 5 124,878,015 (GRCm39) missense possibly damaging 0.96
R8945:Dnah10 UTSW 5 124,891,006 (GRCm39) missense probably damaging 0.99
R8990:Dnah10 UTSW 5 124,814,057 (GRCm39) missense
R9001:Dnah10 UTSW 5 124,852,515 (GRCm39) missense probably damaging 1.00
R9006:Dnah10 UTSW 5 124,820,783 (GRCm39) missense probably benign 0.23
R9060:Dnah10 UTSW 5 124,905,141 (GRCm39) missense probably damaging 1.00
R9085:Dnah10 UTSW 5 124,839,237 (GRCm39) missense
R9133:Dnah10 UTSW 5 124,859,423 (GRCm39) missense probably damaging 1.00
R9155:Dnah10 UTSW 5 124,907,475 (GRCm39) missense probably damaging 0.99
R9220:Dnah10 UTSW 5 124,871,437 (GRCm39) missense probably benign 0.05
R9234:Dnah10 UTSW 5 124,818,989 (GRCm39) missense possibly damaging 0.94
R9264:Dnah10 UTSW 5 124,813,900 (GRCm39) missense probably damaging 1.00
R9266:Dnah10 UTSW 5 124,845,990 (GRCm39) missense probably benign 0.00
R9386:Dnah10 UTSW 5 124,871,507 (GRCm39) critical splice donor site probably null
R9446:Dnah10 UTSW 5 124,823,677 (GRCm39) missense probably damaging 1.00
R9484:Dnah10 UTSW 5 124,900,508 (GRCm39) missense probably damaging 1.00
R9594:Dnah10 UTSW 5 124,907,107 (GRCm39) missense probably damaging 1.00
R9691:Dnah10 UTSW 5 124,852,249 (GRCm39) missense probably damaging 0.98
RF015:Dnah10 UTSW 5 124,895,141 (GRCm39) missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124,854,971 (GRCm39) missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
U24488:Dnah10 UTSW 5 124,891,044 (GRCm39) missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124,842,761 (GRCm39) missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124,852,419 (GRCm39) missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124,819,019 (GRCm39) missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124,895,052 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah10 UTSW 5 124,824,683 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGAAAGGAGCTGCTCATGG -3'
(R):5'- ACAGGGTCAGCCTTCTAGAAC -3'

Sequencing Primer
(F):5'- TGGCTGAACGACCTGGATG -3'
(R):5'- CTAGAACAATGTGTGACCTTGGCTC -3'
Posted On 2016-04-15