Incidental Mutation 'R4903:Chrna3'
ID377955
Institutional Source Beutler Lab
Gene Symbol Chrna3
Ensembl Gene ENSMUSG00000032303
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 3
SynonymsA730007P14Rik, Acra3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, alpha 3, (a)3, Acra-3
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55010111-55026562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55015526 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 333 (T333A)
Ref Sequence ENSEMBL: ENSMUSP00000150636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000214204]
Predicted Effect probably benign
Transcript: ENSMUST00000034851
AA Change: T333A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303
AA Change: T333A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214204
AA Change: T333A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation show high postnatal and postweaning mortality. Mutants show reduced bladder contractility resulting in enlarged bladder, infections and urinary stones. Eyes are small, with dilated ocular pupils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Chrna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Chrna3 APN 9 55016006 missense probably benign 0.01
IGL02484:Chrna3 APN 9 55015537 missense probably damaging 1.00
R0494:Chrna3 UTSW 9 55022278 missense probably damaging 1.00
R0538:Chrna3 UTSW 9 55016006 missense probably benign 0.01
R0557:Chrna3 UTSW 9 55015865 missense probably damaging 1.00
R0674:Chrna3 UTSW 9 55015172 missense probably damaging 1.00
R1552:Chrna3 UTSW 9 55015908 missense probably benign 0.16
R1750:Chrna3 UTSW 9 55016057 missense probably damaging 1.00
R2191:Chrna3 UTSW 9 55016045 missense probably damaging 1.00
R2989:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3114:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3153:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3154:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3434:Chrna3 UTSW 9 55024326 missense possibly damaging 0.95
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3733:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R4758:Chrna3 UTSW 9 55022276 missense probably damaging 1.00
R5430:Chrna3 UTSW 9 55012908 missense probably damaging 0.98
R5795:Chrna3 UTSW 9 55015268 missense probably benign 0.17
R6546:Chrna3 UTSW 9 55015901 missense probably damaging 1.00
R6806:Chrna3 UTSW 9 55015810 missense probably damaging 1.00
R7516:Chrna3 UTSW 9 55015369 missense probably benign 0.00
R7703:Chrna3 UTSW 9 55016124 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCCACATGTCCCATCTTGG -3'
(R):5'- AGAAGGTGACGCTCTGCATC -3'

Sequencing Primer
(F):5'- ACATGTCCCATCTTGGCAGGG -3'
(R):5'- GACGCTCTGCATCTCCGTG -3'
Posted On2016-04-15