Incidental Mutation 'R4903:Lrig3'
ID377964
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 125996613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807] [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000074807
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074807
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1398:Lrig3 UTSW 10 126003088 missense probably benign 0.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1673:Lrig3 UTSW 10 126010167 missense probably damaging 1.00
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2160:Lrig3 UTSW 10 125997696 missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4075:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6484:Lrig3 UTSW 10 125996609 splice site probably null
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125997124 missense probably damaging 1.00
R7177:Lrig3 UTSW 10 126006843 missense probably benign 0.02
R7347:Lrig3 UTSW 10 126009966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCCCTGTAATAAATTGGAGG -3'
(R):5'- CCAGGTGTCCACTCAGTATTTG -3'

Sequencing Primer
(F):5'- CAGTTTTAGCACTGACTGG -3'
(R):5'- CCACTCAGTATTTGGGGGTCAG -3'
Posted On2016-04-15