Incidental Mutation 'R4903:Lrig3'
ID 377964
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Name leucine-rich repeats and immunoglobulin-like domains 3
Synonyms 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
MMRRC Submission 042506-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R4903 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 125802088-125851228 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 125832482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807] [ENSMUST00000074807]
AlphaFold Q6P1C6
PDB Structure Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000074807
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074807
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,645,119 (GRCm39) E335* probably null Het
Abca9 A G 11: 110,037,827 (GRCm39) Y508H probably damaging Het
Abcc9 A T 6: 142,546,691 (GRCm39) L1347H probably damaging Het
Acox3 A G 5: 35,747,080 (GRCm39) N166D probably damaging Het
Adam5 T C 8: 25,276,248 (GRCm39) Y473C probably damaging Het
Agbl2 A G 2: 90,627,817 (GRCm39) I207M possibly damaging Het
Akna C A 4: 63,292,274 (GRCm39) R1130S probably damaging Het
Alg12 A T 15: 88,698,743 (GRCm39) I194N probably damaging Het
Alk T A 17: 72,176,558 (GRCm39) H1582L probably damaging Het
Atn1 G C 6: 124,720,220 (GRCm39) probably benign Het
Carhsp1 T C 16: 8,478,864 (GRCm39) T130A probably damaging Het
Chrna3 T C 9: 54,922,810 (GRCm39) T333A probably benign Het
Ctsr T A 13: 61,310,945 (GRCm39) I34L probably benign Het
Cxcl16 A G 11: 70,346,519 (GRCm39) V208A probably benign Het
Dars2 G C 1: 160,878,941 (GRCm39) P362R probably benign Het
Dnah10 A G 5: 124,894,812 (GRCm39) E3459G probably damaging Het
Dus2 G A 8: 106,771,437 (GRCm39) D188N probably benign Het
Ece2 C T 16: 20,449,972 (GRCm39) R189* probably null Het
Egfr A T 11: 16,858,949 (GRCm39) D976V probably damaging Het
Egr2 T A 10: 67,374,163 (GRCm39) I51N probably damaging Het
Exoc3l4 A G 12: 111,395,155 (GRCm39) H591R probably benign Het
G2e3 A G 12: 51,418,413 (GRCm39) I603V probably benign Het
Gm11564 A C 11: 99,705,858 (GRCm39) C191G unknown Het
Gpatch8 A G 11: 102,370,959 (GRCm39) S860P unknown Het
Gprin1 C G 13: 54,885,742 (GRCm39) W844S probably damaging Het
Hhipl2 T A 1: 183,207,698 (GRCm39) Y252* probably null Het
Hormad1 T A 3: 95,492,531 (GRCm39) probably null Het
Hrg A G 16: 22,779,901 (GRCm39) probably benign Het
Hsh2d C T 8: 72,947,372 (GRCm39) A23V probably benign Het
Ints6 A G 14: 62,939,911 (GRCm39) L593P probably damaging Het
Jak2 A G 19: 29,252,436 (GRCm39) S129G probably benign Het
Kif1a C T 1: 92,949,456 (GRCm39) E1579K probably damaging Het
Lhcgr A T 17: 89,049,789 (GRCm39) I579N probably damaging Het
Man2c1 C A 9: 57,046,240 (GRCm39) Q465K probably benign Het
Map3k5 T A 10: 19,994,235 (GRCm39) L1043Q probably null Het
Map4k1 A T 7: 28,682,427 (GRCm39) H16L probably benign Het
Mapk8ip3 A G 17: 25,120,183 (GRCm39) S946P probably benign Het
Mrpl50 T C 4: 49,514,488 (GRCm39) Y61C probably damaging Het
Myf5 A T 10: 107,321,733 (GRCm39) C20* probably null Het
Nek11 T C 9: 105,191,921 (GRCm39) K163R possibly damaging Het
Or1l4b A T 2: 37,036,383 (GRCm39) H53L probably benign Het
Or4c105 A T 2: 88,648,342 (GRCm39) I276L probably benign Het
Pcdhga9 C A 18: 37,872,058 (GRCm39) T629K probably damaging Het
Pglyrp1 A G 7: 18,624,128 (GRCm39) N137S probably benign Het
Pip5k1a T C 3: 94,978,094 (GRCm39) I275V probably benign Het
Pitpnm2 T A 5: 124,290,668 (GRCm39) Y6F probably damaging Het
Pkd1 T G 17: 24,790,976 (GRCm39) V1057G probably benign Het
Plcb3 C A 19: 6,933,211 (GRCm39) R970L probably damaging Het
Plekha5 T A 6: 140,532,093 (GRCm39) M586K probably damaging Het
Ppp4r4 T A 12: 103,557,030 (GRCm39) probably null Het
Rasal3 C T 17: 32,616,357 (GRCm39) C278Y probably damaging Het
Rbm34 T C 8: 127,678,087 (GRCm39) D269G possibly damaging Het
Rnf32 G A 5: 29,403,576 (GRCm39) R7H probably benign Het
Sema3d A G 5: 12,613,125 (GRCm39) K401E probably benign Het
Sema7a T C 9: 57,862,378 (GRCm39) Y194H probably benign Het
Senp5 A T 16: 31,802,117 (GRCm39) Y585N probably damaging Het
Serpinb9 T A 13: 33,192,847 (GRCm39) W135R probably damaging Het
Shbg C T 11: 69,505,912 (GRCm39) S365N probably benign Het
Slc39a6 A T 18: 24,730,925 (GRCm39) S65T probably damaging Het
Stk3 T C 15: 34,959,212 (GRCm39) E320G probably damaging Het
Syk T A 13: 52,765,117 (GRCm39) H81Q probably damaging Het
Tet1 A G 10: 62,658,437 (GRCm39) W1470R probably damaging Het
Thada C A 17: 84,559,828 (GRCm39) V1450L possibly damaging Het
Tmem241 A G 18: 12,237,176 (GRCm39) S87P probably damaging Het
Trdv1 T A 14: 54,119,375 (GRCm39) probably benign Het
Trim40 T C 17: 37,194,117 (GRCm39) E192G possibly damaging Het
Trip11 A T 12: 101,853,065 (GRCm39) probably null Het
Trmt2a T A 16: 18,067,418 (GRCm39) C30* probably null Het
Tshr A G 12: 91,367,962 (GRCm39) D35G probably benign Het
Tssc4 T C 7: 142,624,322 (GRCm39) V210A probably damaging Het
Ttk T A 9: 83,747,201 (GRCm39) I680N probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl4a T C 18: 80,250,493 (GRCm39) F30L probably damaging Het
Ubac2 G T 14: 122,231,650 (GRCm39) C192F probably benign Het
Vmn1r12 A G 6: 57,136,502 (GRCm39) T156A possibly damaging Het
Zfp747l1 T A 7: 126,984,578 (GRCm39) T175S probably benign Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 125,849,017 (GRCm39) missense probably benign 0.00
IGL00426:Lrig3 APN 10 125,808,006 (GRCm39) nonsense probably null
IGL00969:Lrig3 APN 10 125,832,984 (GRCm39) missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125,830,335 (GRCm39) missense probably benign 0.01
IGL01510:Lrig3 APN 10 125,844,567 (GRCm39) missense probably damaging 1.00
IGL01825:Lrig3 APN 10 125,845,886 (GRCm39) missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125,833,041 (GRCm39) missense probably damaging 1.00
IGL02377:Lrig3 APN 10 125,850,743 (GRCm39) missense probably benign 0.00
IGL02648:Lrig3 APN 10 125,802,463 (GRCm39) missense probably benign
IGL02832:Lrig3 APN 10 125,842,871 (GRCm39) missense probably benign 0.37
IGL03266:Lrig3 APN 10 125,849,151 (GRCm39) missense probably benign 0.28
R0023:Lrig3 UTSW 10 125,846,088 (GRCm39) missense probably damaging 1.00
R0129:Lrig3 UTSW 10 125,842,812 (GRCm39) missense probably damaging 1.00
R0183:Lrig3 UTSW 10 125,846,061 (GRCm39) missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125,807,986 (GRCm39) splice site probably benign
R0233:Lrig3 UTSW 10 125,849,395 (GRCm39) splice site probably null
R0233:Lrig3 UTSW 10 125,849,395 (GRCm39) splice site probably null
R0336:Lrig3 UTSW 10 125,802,574 (GRCm39) missense probably benign 0.04
R0348:Lrig3 UTSW 10 125,849,317 (GRCm39) nonsense probably null
R0502:Lrig3 UTSW 10 125,844,605 (GRCm39) missense probably damaging 1.00
R0639:Lrig3 UTSW 10 125,846,090 (GRCm39) missense probably damaging 1.00
R1099:Lrig3 UTSW 10 125,842,883 (GRCm39) splice site probably null
R1220:Lrig3 UTSW 10 125,832,945 (GRCm39) missense probably damaging 1.00
R1230:Lrig3 UTSW 10 125,838,840 (GRCm39) missense probably damaging 1.00
R1398:Lrig3 UTSW 10 125,838,957 (GRCm39) missense probably benign 0.00
R1451:Lrig3 UTSW 10 125,845,926 (GRCm39) missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 125,844,567 (GRCm39) missense probably damaging 1.00
R1545:Lrig3 UTSW 10 125,844,416 (GRCm39) missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125,833,570 (GRCm39) missense probably benign 0.12
R1665:Lrig3 UTSW 10 125,833,570 (GRCm39) missense probably benign 0.12
R1673:Lrig3 UTSW 10 125,846,036 (GRCm39) missense probably damaging 1.00
R1778:Lrig3 UTSW 10 125,845,944 (GRCm39) missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125,832,920 (GRCm39) splice site probably null
R1840:Lrig3 UTSW 10 125,849,258 (GRCm39) nonsense probably null
R1882:Lrig3 UTSW 10 125,845,694 (GRCm39) missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 125,838,262 (GRCm39) splice site probably benign
R2160:Lrig3 UTSW 10 125,833,565 (GRCm39) missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125,832,478 (GRCm39) splice site probably null
R2294:Lrig3 UTSW 10 125,802,363 (GRCm39) nonsense probably null
R2518:Lrig3 UTSW 10 125,830,310 (GRCm39) missense probably benign 0.07
R3037:Lrig3 UTSW 10 125,845,901 (GRCm39) missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125,833,056 (GRCm39) missense probably damaging 1.00
R4073:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4074:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4075:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4077:Lrig3 UTSW 10 125,845,656 (GRCm39) missense probably damaging 1.00
R4079:Lrig3 UTSW 10 125,845,656 (GRCm39) missense probably damaging 1.00
R4405:Lrig3 UTSW 10 125,846,877 (GRCm39) missense probably benign 0.00
R4425:Lrig3 UTSW 10 125,849,273 (GRCm39) missense probably benign 0.00
R4505:Lrig3 UTSW 10 125,849,216 (GRCm39) missense probably benign 0.00
R4860:Lrig3 UTSW 10 125,846,921 (GRCm39) missense probably benign 0.36
R4860:Lrig3 UTSW 10 125,846,921 (GRCm39) missense probably benign 0.36
R5201:Lrig3 UTSW 10 125,849,020 (GRCm39) missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 125,842,559 (GRCm39) missense probably damaging 1.00
R5402:Lrig3 UTSW 10 125,844,609 (GRCm39) missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125,808,003 (GRCm39) missense probably damaging 1.00
R5792:Lrig3 UTSW 10 125,845,788 (GRCm39) missense probably damaging 1.00
R5903:Lrig3 UTSW 10 125,844,347 (GRCm39) missense probably damaging 1.00
R6280:Lrig3 UTSW 10 125,846,848 (GRCm39) missense probably benign 0.18
R6484:Lrig3 UTSW 10 125,832,478 (GRCm39) splice site probably null
R6985:Lrig3 UTSW 10 125,850,738 (GRCm39) missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125,832,993 (GRCm39) missense probably damaging 1.00
R7177:Lrig3 UTSW 10 125,842,712 (GRCm39) missense probably benign 0.02
R7347:Lrig3 UTSW 10 125,845,835 (GRCm39) missense probably damaging 1.00
R9093:Lrig3 UTSW 10 125,845,950 (GRCm39) missense possibly damaging 0.51
R9188:Lrig3 UTSW 10 125,838,935 (GRCm39) missense possibly damaging 0.80
R9295:Lrig3 UTSW 10 125,850,722 (GRCm39) missense probably benign 0.00
R9378:Lrig3 UTSW 10 125,832,953 (GRCm39) missense probably damaging 0.98
R9526:Lrig3 UTSW 10 125,850,736 (GRCm39) missense probably benign
R9567:Lrig3 UTSW 10 125,845,964 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTCCCTGTAATAAATTGGAGG -3'
(R):5'- CCAGGTGTCCACTCAGTATTTG -3'

Sequencing Primer
(F):5'- CAGTTTTAGCACTGACTGG -3'
(R):5'- CCACTCAGTATTTGGGGGTCAG -3'
Posted On 2016-04-15