Mutagenetix > Incidental Mutations

Incidental Mutation 'R4903:Egfr'

377965

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

042506-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R4903 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16908949 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 976 (D976V)

Ref Sequence

ENSEMBL: ENSMUSP00000020329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020329
AA Change: D976V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: D976V

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138518

Meta Mutation Damage Score

0.3195

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	T	A	7: 127,385,406	T175S	probably benign	Het
A430033K04Rik	G	T	5: 138,646,857	E335*	probably null	Het
Abca9	A	G	11: 110,147,001	Y508H	probably damaging	Het
Abcc9	A	T	6: 142,600,965	L1347H	probably damaging	Het
Acox3	A	G	5: 35,589,736	N166D	probably damaging	Het
Adam5	T	C	8: 24,786,232	Y473C	probably damaging	Het
Agbl2	A	G	2: 90,797,473	I207M	possibly damaging	Het
Akna	C	A	4: 63,374,037	R1130S	probably damaging	Het
Alg12	A	T	15: 88,814,540	I194N	probably damaging	Het
Alk	T	A	17: 71,869,563	H1582L	probably damaging	Het
Atn1	G	C	6: 124,743,257		probably benign	Het
Carhsp1	T	C	16: 8,661,000	T130A	probably damaging	Het
Chrna3	T	C	9: 55,015,526	T333A	probably benign	Het
Ctsr	T	A	13: 61,163,131	I34L	probably benign	Het
Cxcl16	A	G	11: 70,455,693	V208A	probably benign	Het
Dars2	G	C	1: 161,051,371	P362R	probably benign	Het
Dnah10	A	G	5: 124,817,748	E3459G	probably damaging	Het
Dus2	G	A	8: 106,044,805	D188N	probably benign	Het
Ece2	C	T	16: 20,631,222	R189*	probably null	Het
Egr2	T	A	10: 67,538,333	I51N	probably damaging	Het
Exoc3l4	A	G	12: 111,428,721	H591R	probably benign	Het
G2e3	A	G	12: 51,371,630	I603V	probably benign	Het
Gm11564	A	C	11: 99,815,032	C191G	unknown	Het
Gpatch8	A	G	11: 102,480,133	S860P	unknown	Het
Gprin1	C	G	13: 54,737,929	W844S	probably damaging	Het
Hhipl2	T	A	1: 183,426,790	Y252*	probably null	Het
Hormad1	T	A	3: 95,585,220		probably null	Het
Hrg	A	G	16: 22,961,151		probably benign	Het
Hsh2d	C	T	8: 72,193,528	A23V	probably benign	Het
Ints6	A	G	14: 62,702,462	L593P	probably damaging	Het
Jak2	A	G	19: 29,275,036	S129G	probably benign	Het
Kif1a	C	T	1: 93,021,734	E1579K	probably damaging	Het
Lhcgr	A	T	17: 88,742,361	I579N	probably damaging	Het
Lrig3	A	T	10: 125,996,613		probably null	Het
Man2c1	C	A	9: 57,138,956	Q465K	probably benign	Het
Map3k5	T	A	10: 20,118,489	L1043Q	probably null	Het
Map4k1	A	T	7: 28,983,002	H16L	probably benign	Het
Mapk8ip3	A	G	17: 24,901,209	S946P	probably benign	Het
Mrpl50	T	C	4: 49,514,488	Y61C	probably damaging	Het
Myf5	A	T	10: 107,485,872	C20*	probably null	Het
Nek11	T	C	9: 105,314,722	K163R	possibly damaging	Het
Olfr1202	A	T	2: 88,817,998	I276L	probably benign	Het
Olfr364-ps1	A	T	2: 37,146,371	H53L	probably benign	Het
Pcdhga9	C	A	18: 37,739,005	T629K	probably damaging	Het
Pglyrp1	A	G	7: 18,890,203	N137S	probably benign	Het
Pip5k1a	T	C	3: 95,070,783	I275V	probably benign	Het
Pitpnm2	T	A	5: 124,152,605	Y6F	probably damaging	Het
Pkd1	T	G	17: 24,572,002	V1057G	probably benign	Het
Plcb3	C	A	19: 6,955,843	R970L	probably damaging	Het
Plekha5	T	A	6: 140,586,367	M586K	probably damaging	Het
Ppp4r4	T	A	12: 103,590,771		probably null	Het
Rasal3	C	T	17: 32,397,383	C278Y	probably damaging	Het
Rbm34	T	C	8: 126,951,337	D269G	possibly damaging	Het
Rnf32	G	A	5: 29,198,578	R7H	probably benign	Het
Sema3d	A	G	5: 12,563,158	K401E	probably benign	Het
Sema7a	T	C	9: 57,955,095	Y194H	probably benign	Het
Senp5	A	T	16: 31,983,299	Y585N	probably damaging	Het
Serpinb9	T	A	13: 33,008,864	W135R	probably damaging	Het
Shbg	C	T	11: 69,615,086	S365N	probably benign	Het
Slc39a6	A	T	18: 24,597,868	S65T	probably damaging	Het
Stk3	T	C	15: 34,959,066	E320G	probably damaging	Het
Syk	T	A	13: 52,611,081	H81Q	probably damaging	Het
Tet1	A	G	10: 62,822,658	W1470R	probably damaging	Het
Thada	C	A	17: 84,252,400	V1450L	possibly damaging	Het
Tmem241	A	G	18: 12,104,119	S87P	probably damaging	Het
Trdv1	T	A	14: 53,881,918		probably benign	Het
Trim40	T	C	17: 36,883,225	E192G	possibly damaging	Het
Trip11	A	T	12: 101,886,806		probably null	Het
Trmt2a	T	A	16: 18,249,554	C30*	probably null	Het
Tshr	A	G	12: 91,401,188	D35G	probably benign	Het
Tssc4	T	C	7: 143,070,585	V210A	probably damaging	Het
Ttk	T	A	9: 83,865,148	I680N	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl4a	T	C	18: 80,207,278	F30L	probably damaging	Het
Ubac2	G	T	14: 121,994,238	C192F	probably benign	Het
Vmn1r12	A	G	6: 57,159,517	T156A	possibly damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTAGCAAGATCACAGC -3'
(R):5'- TGGACTGCTCAAATGCAATGATG -3'

Sequencing Primer
(F):5'- CATCACTTAAAGCAATGCCCTCCTTG -3'
(R):5'- GTGAGAGTCACCACTTATCCCCATG -3'

Posted On

2016-04-15