Incidental Mutation 'R4903:G2e3'
ID377973
Institutional Source Beutler Lab
Gene Symbol G2e3
Ensembl Gene ENSMUSG00000035293
Gene NameG2/M-phase specific E3 ubiquitin ligase
Synonyms6030408C04Rik, D930034K21Rik
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51348061-51376986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51371630 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 603 (I603V)
Ref Sequence ENSEMBL: ENSMUSP00000113270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054308] [ENSMUST00000119211] [ENSMUST00000121521]
Predicted Effect probably benign
Transcript: ENSMUST00000054308
AA Change: I580V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000054474
Gene: ENSMUSG00000035293
AA Change: I580V

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 1e-2 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 402 692 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119211
AA Change: I603V

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113270
Gene: ENSMUSG00000035293
AA Change: I603V

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 383 717 3.1e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000121521
AA Change: I486V
SMART Domains Protein: ENSMUSP00000113191
Gene: ENSMUSG00000035293
AA Change: I486V

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 298 598 4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152236
Meta Mutation Damage Score 0.1190 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele that inactivates this gene die prior to implantation due to massive apoptosis which results in involution of the blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in G2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:G2e3 APN 12 51353798 critical splice acceptor site probably null
IGL00793:G2e3 APN 12 51367762 missense probably benign 0.00
IGL02222:G2e3 APN 12 51363233 missense probably damaging 1.00
IGL02335:G2e3 APN 12 51369158 missense probably benign 0.19
IGL03134:G2e3 APN 12 51364030 intron probably benign
Amadeus UTSW 12 51353789 splice site probably null
R1868:G2e3 UTSW 12 51353629 missense probably benign 0.44
R2060:G2e3 UTSW 12 51372606 missense probably damaging 1.00
R3814:G2e3 UTSW 12 51353661 missense probably benign 0.28
R4355:G2e3 UTSW 12 51365337 missense probably benign 0.00
R4360:G2e3 UTSW 12 51363414 splice site probably benign
R4966:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4974:G2e3 UTSW 12 51369139 missense probably benign 0.00
R5399:G2e3 UTSW 12 51357194 critical splice donor site probably null
R5406:G2e3 UTSW 12 51372666 missense probably damaging 0.97
R5739:G2e3 UTSW 12 51372504 missense possibly damaging 0.94
R6225:G2e3 UTSW 12 51369136 missense possibly damaging 0.77
R6625:G2e3 UTSW 12 51353789 splice site probably null
R7458:G2e3 UTSW 12 51365507 missense possibly damaging 0.67
R7529:G2e3 UTSW 12 51371604 missense probably damaging 1.00
R7713:G2e3 UTSW 12 51369056 missense probably damaging 0.99
R7748:G2e3 UTSW 12 51371667 missense probably benign 0.00
R7998:G2e3 UTSW 12 51353841 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAGTCATGCAACGTAGTACTTAC -3'
(R):5'- GTCTTCTTAGGGAAAGAGCATAAACC -3'

Sequencing Primer
(F):5'- GGTAGCTCACAACCGTCTGTAATG -3'
(R):5'- TCCGCTACCGAGTGAATT -3'
Posted On2016-04-15