Incidental Mutation 'R4903:Stk3'
ID 377985
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Name serine/threonine kinase 3
Synonyms mess1, MST, Mst2
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4903 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 34875496-35178921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34959066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 320 (E320G)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
AlphaFold Q9JI10
Predicted Effect probably damaging
Transcript: ENSMUST00000018476
AA Change: E320G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: E320G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067033
AA Change: E250G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: E250G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128425
Predicted Effect probably benign
Transcript: ENSMUST00000226555
AA Change: E318G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226730
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
R7862:Stk3 UTSW 15 35115586 missense possibly damaging 0.90
R8354:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8454:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8996:Stk3 UTSW 15 34945062 missense possibly damaging 0.51
R9160:Stk3 UTSW 15 35099465 missense probably damaging 0.99
R9366:Stk3 UTSW 15 35072488 missense probably damaging 1.00
R9777:Stk3 UTSW 15 35114645 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGAAAGGGCTCCATACTTTTC -3'
(R):5'- TCAGCTATCTTCAAGAGGTCTTTG -3'

Sequencing Primer
(F):5'- AAGGGCTCCATACTTTTCATAGTTC -3'
(R):5'- CTTACAGGATGTGCAACAGA -3'
Posted On 2016-04-15